ID: 1076891185

View in Genome Browser
Species Human (GRCh38)
Location 10:133284284-133284306
Sequence CTTTCCTGGCGTGGGCTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076891185 Original CRISPR CTTTCCTGGCGTGGGCTCCG AGG (reversed) Intronic
900414356 1:2528255-2528277 CAGTCCTGGCATGGGCTCCGGGG - Intergenic
900981809 1:6050033-6050055 CTTTCCTGGGGTGAGCTCCAGGG - Intronic
901150922 1:7100730-7100752 CTTTCCTGGCATTGGCACAGGGG + Intronic
902999966 1:20258393-20258415 CTTTCCTGGGGTCGGCCCTGGGG - Intergenic
903243552 1:21999772-21999794 CTTCCCTGGCGTAGGGTCTGGGG + Intergenic
912190855 1:107338557-107338579 ATTTCCTGGCTTGGCCTCCTAGG - Intronic
916863884 1:168835698-168835720 TTTACCTGGCGTGGGGTCCGTGG + Intergenic
919426785 1:197442265-197442287 CTTTGCTGGCGAGCGCTGCGAGG + Exonic
1067425215 10:46204676-46204698 CTTTCCTAGCGGGGGCCCTGCGG - Intergenic
1067943294 10:50674710-50674732 CTTTCCTAGCGGGGGCCCTGCGG - Intergenic
1074345355 10:112679885-112679907 CTATCCTGGAGTGGGCTTCATGG + Intronic
1074432161 10:113403497-113403519 CTTTCCTGGTCTGGGCTTTGTGG - Intergenic
1076373898 10:129971332-129971354 CGGGCCTGGCGCGGGCTCCGGGG + Intergenic
1076485614 10:130814746-130814768 CTGTCCTGGAGTTGGCTCCAGGG + Intergenic
1076891185 10:133284284-133284306 CTTTCCTGGCGTGGGCTCCGAGG - Intronic
1077354533 11:2109047-2109069 CTTTCCTGGCTTGGGTTTCTGGG + Intergenic
1077360991 11:2139997-2140019 CGCACCTGGCGGGGGCTCCGGGG - Intronic
1077495224 11:2884033-2884055 CGCCCCTGGCGTGGGCTCGGTGG - Exonic
1078180153 11:9004270-9004292 CTGGACTGGCGTGGGCTCTGGGG + Intergenic
1080695738 11:34601524-34601546 CTTTTCTGGGGTGGGGTCTGGGG + Intergenic
1083919885 11:65776780-65776802 CCTGCCTGGCGTGAGCTCCCTGG + Exonic
1084593457 11:70103827-70103849 CTTTCATGGCGTGGGCGGGGTGG + Intronic
1090438661 11:126708561-126708583 CTGTTCCGACGTGGGCTCCGGGG + Intronic
1096546971 12:52346839-52346861 GTTTCCTGGCCTGGGCTCTGAGG + Intergenic
1097184068 12:57187259-57187281 CTTCACAGACGTGGGCTCCGTGG + Exonic
1103698968 12:122838078-122838100 CTTTCCTCCCCTGGGCTCCTGGG + Intronic
1103850627 12:123930646-123930668 CTCTCCTGGTGGGGGCTCCTCGG + Intronic
1104178621 12:126356596-126356618 CTTTCCTGGCTTCTGCTCCCTGG - Intergenic
1104847917 12:131856029-131856051 CCTGCCTGGCCTGGGCTCAGGGG - Intergenic
1108323659 13:49309276-49309298 CTTGCCTGGCATGGACCCCGAGG - Exonic
1110892962 13:80713109-80713131 GTTTCATGGAGTGGGCTCAGGGG - Intergenic
1110901205 13:80827146-80827168 CTTTCCTGGCTTGGGTACCAGGG + Intergenic
1111722505 13:91964298-91964320 GGTTGCTGGTGTGGGCTCCGTGG + Intronic
1113586373 13:111468734-111468756 CGTGGCTGGCGTGGGCTGCGAGG + Intergenic
1116076648 14:40119509-40119531 CTGTCCTGGCAGGGGCTCTGAGG - Intergenic
1117556746 14:56894002-56894024 CTTTCCTGGAAAGGCCTCCGAGG - Intergenic
1118140224 14:63072417-63072439 CTTTCCAGCTGTGGGCTCCATGG - Intronic
1121774817 14:96583729-96583751 CCTTCCTGGCGTGGCCACCATGG - Intergenic
1122812478 14:104295972-104295994 CTGTCCTGGCGTGGGGACCCGGG + Intergenic
1124036984 15:26062959-26062981 CTTTCCTGGCCTGGGCTGTGTGG + Intergenic
1124211774 15:27770228-27770250 CGTTCAGGGCGGGGGCTCCGCGG + Intronic
1124413777 15:29457942-29457964 CTTGCCAGGCCTGGGCTCTGTGG - Intronic
1126144787 15:45464377-45464399 CCTTCCTGGCGAGGGCCCCTAGG - Intergenic
1128576949 15:68782851-68782873 CTTTCCTAACCAGGGCTCCGGGG + Intronic
1128717553 15:69919799-69919821 CTTTCATGGTGGGGGCTCTGAGG + Intergenic
1133801913 16:9091647-9091669 CAGTCTTGGGGTGGGCTCCGCGG + Exonic
1134193015 16:12137025-12137047 CTTTCCTAGGCTGGGCACCGTGG - Intronic
1134291152 16:12903334-12903356 CCTGGCTGGCGTGGACTCCGGGG + Intronic
1134662458 16:15994380-15994402 CTTTCCTGGCAAGGGCTCTGAGG - Intronic
1137589603 16:49685572-49685594 GTTTCCTGGCTTGGGCATCGAGG - Intronic
1142684800 17:1571626-1571648 CTTGCCTGCCGTGCACTCCGAGG - Intronic
1143086809 17:4422201-4422223 CTTTCCTGACCTGGACTCCTAGG - Intergenic
1143098280 17:4490183-4490205 CTGTCCTGCTGTGGGCTGCGAGG - Intergenic
1143866153 17:9925590-9925612 CTTTCCGGGCCTGGGGTCCAAGG + Exonic
1144841825 17:18191403-18191425 CTTCCAAGGCCTGGGCTCCGTGG + Intronic
1146846096 17:36183012-36183034 GTTTCCGGGGCTGGGCTCCGGGG + Intronic
1152284348 17:79403634-79403656 CTTTCCTGGCTTGGGCAGGGCGG + Intronic
1156502291 18:37567283-37567305 CGTTCCTGCCGTGGGGACCGGGG + Intergenic
1159670232 18:71212783-71212805 CTTCGTGGGCGTGGGCTCCGCGG - Intergenic
1160236142 18:77087996-77088018 CGTTCCTTGCCTGGGCTCGGAGG - Intronic
1163635002 19:18433630-18433652 CTTGCCGGGGGTGGGATCCGGGG + Intronic
1163724258 19:18913579-18913601 CCTCCCTGGCCTGGGCTCAGGGG - Intronic
1166746587 19:45144780-45144802 CTTTCCTGACTTGGCCTCCTGGG + Intronic
925443346 2:3907180-3907202 CTTTCCTGGCCTGGTATCCTGGG + Intergenic
930451348 2:51542041-51542063 CTTTCCTGGAGTGAAATCCGAGG - Intergenic
931239550 2:60439801-60439823 CTTTCCTGGCTTAGGCTGGGAGG - Intergenic
932722011 2:74145405-74145427 CTGTGCTGGCGAGGGCTCAGGGG - Intronic
932771672 2:74503840-74503862 CTTTCCTGACATGGTCTCCAAGG - Intergenic
934026202 2:88003355-88003377 CTTCCCTGCCGTGCGCCCCGCGG + Intergenic
934910954 2:98253920-98253942 CTTTCCTGCGGTGGCCTCCCTGG + Intronic
944968803 2:204967752-204967774 TTTTCCTGTTGTTGGCTCCGGGG + Intronic
946395515 2:219442076-219442098 GTTTCCAGGTGAGGGCTCCGGGG + Intronic
947552017 2:231053096-231053118 CTTTCCCGGCGAGGCCACCGTGG - Intergenic
948423900 2:237876248-237876270 CTCTCCTTGGGTGGGCTCCCTGG + Intronic
948588512 2:239035695-239035717 CGTTCCACGCGTGGGCACCGCGG + Intergenic
1171422014 20:25023959-25023981 CTTTCCTGGGGTTTGCTCCTGGG - Intronic
1171432223 20:25090304-25090326 CTTTTCTGCAGTGGGGTCCGAGG - Intergenic
1172006382 20:31821519-31821541 CTTGGCTGGCCTGGGATCCGTGG - Exonic
1173624950 20:44465881-44465903 CCTTTCTGTCGTGGGCTCCATGG + Intergenic
1175286487 20:57840253-57840275 CTTTCCTCCCATGGGCTCTGTGG + Intergenic
1175980579 20:62736583-62736605 CTTTCCCAGCGAGGACTCCGAGG + Intronic
1176026867 20:62990250-62990272 CGTTCCTGGGGTGGCCTCCAAGG + Intergenic
1176072976 20:63236336-63236358 CTTCCCCGGCATGGGCTCTGAGG + Exonic
1179791006 21:43755943-43755965 CTTCCCCGGCCTGGGCTGCGGGG - Exonic
1180892648 22:19301384-19301406 CTTTCCTGGGCTGGGTGCCGTGG + Intergenic
1181494056 22:23278013-23278035 CTTTCCAGGCCTGGGTTCTGAGG + Intronic
1183063886 22:35350767-35350789 CGTTCCTGGATTGGGCTCTGCGG + Intergenic
1183335293 22:37242817-37242839 CTCTCCTGGCCTGGGCCCTGTGG - Intronic
1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG + Intronic
1183961531 22:41414265-41414287 CCTTCCTGGCCTGGACTCTGGGG + Intergenic
1184636370 22:45835233-45835255 TTTGCCTGGCGTGGGCTCATGGG + Intronic
1185017246 22:48351976-48351998 CTCTCATGGCGAGGGCTCCCTGG - Intergenic
952898410 3:38094441-38094463 CTTTCCTGTTATGGGCTCCCAGG - Intronic
954660217 3:52223055-52223077 CTTCCCTGGCCTGCGCTACGTGG - Exonic
954704597 3:52472599-52472621 CTTCCCTGGCGTGAGCTGCAGGG + Intronic
964041777 3:152269304-152269326 CTTCCCTGCCGCGGGCTCTGCGG + Intronic
968645500 4:1738484-1738506 CTCTGCAGGCCTGGGCTCCGGGG + Intronic
968651144 4:1760771-1760793 CTGTCCTGGGCTGGGCTCAGGGG + Intergenic
969709186 4:8832961-8832983 CTCCCCTGGCGTGGGGTCAGCGG - Intergenic
981452293 4:144912175-144912197 CTTTCCTGGGCTGGGCACGGTGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983542954 4:168931746-168931768 CTTTGCTGGGGTGGGCTCACTGG - Intronic
985206614 4:187544805-187544827 TTTTCCAGGCGTGGTCTCAGTGG - Intergenic
985567131 5:624711-624733 CCTGCCTGGCGGGGACTCCGTGG + Intronic
986265413 5:6186125-6186147 CTTTCCTGACCTGGCCTCAGAGG - Intergenic
986668105 5:10120619-10120641 CTTGCCTGGTGTGGGCTCCTGGG - Intergenic
989188798 5:38649875-38649897 CTTTCCTTTCTTGGGCTCTGTGG - Intergenic
992396331 5:76372494-76372516 CTTGCCTGGCAGGGGCTCCCAGG - Intergenic
997654512 5:135545319-135545341 CTTCCCTGGAGTGCGCTCCCAGG + Intergenic
998108267 5:139482061-139482083 CCTCCCTGGGGTGGGTTCCGGGG - Intronic
999259000 5:150226447-150226469 ATTTCCTGGGGTGGGCTTGGTGG + Intronic
1001085748 5:168699052-168699074 GTTTCCTGGCTGGGGCCCCGTGG + Intronic
1002099922 5:176852418-176852440 CTTTCCTGCCTTGGGATCCTTGG - Intronic
1003245042 6:4376249-4376271 CTTTCCTTTTGTGGGCTCTGAGG + Intergenic
1006719066 6:36138485-36138507 CTTGCCTGACGTGGGCCCAGTGG + Intronic
1008030542 6:46688776-46688798 CACTGCTAGCGTGGGCTCCGGGG + Exonic
1013055920 6:106582805-106582827 CTGTCCTGCCGTGGACTCTGTGG - Intronic
1013102397 6:106998028-106998050 CGTTCCAGACGTGGGCTCCCAGG + Intergenic
1014211461 6:118712659-118712681 CTTTCCTGGGCTGGGCGCGGTGG - Intergenic
1015203076 6:130603958-130603980 GTGTCCTGGTGTGGGCTCCCTGG - Intergenic
1018054411 6:160039730-160039752 CTTTCCAGGCTAGGGGTCCGTGG - Intronic
1019592129 7:1840918-1840940 CTATCCTGGCTTGGCCTGCGTGG - Intronic
1019666162 7:2253177-2253199 CTTTCCTGGCAGGGACTCCGGGG - Exonic
1026018905 7:66693395-66693417 GTTTCCTGGCCTGGGCTTCCAGG + Intronic
1032426608 7:131827725-131827747 CTTTCTTTGCCTGGGCTCTGGGG + Intergenic
1035169229 7:157008829-157008851 CTCTCCGGGCTGGGGCTCCGGGG - Intronic
1035567438 8:650747-650769 CTCTTCTGTTGTGGGCTCCGAGG + Intronic
1045501746 8:102748969-102748991 GGTTCCTGGCTTGGGCTCCTGGG + Intergenic
1049214714 8:141402353-141402375 CCCTCCTGGAGTGGGCTCAGGGG + Intronic
1049373834 8:142279855-142279877 CTTACTTGGCAGGGGCTCCGTGG + Intronic
1049565137 8:143334346-143334368 CTTTCCTGGAGTCGGTTCCCGGG - Intronic
1059459607 9:114421348-114421370 CTTGCCTGGCAAGGGCTCTGGGG - Intronic
1062315368 9:135964540-135964562 CTTTGCTAGCGTGGCCTCTGTGG - Intergenic
1185527906 X:793856-793878 CATTCCTGGGCTGGGCACCGTGG - Intergenic