ID: 1076891771

View in Genome Browser
Species Human (GRCh38)
Location 10:133288230-133288252
Sequence TCCGGAGCTCCTCCTCCGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076891765_1076891771 10 Left 1076891765 10:133288197-133288219 CCAGGCGAGGGGGCGTGATGTCC 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG 0: 1
1: 0
2: 1
3: 9
4: 117
1076891758_1076891771 28 Left 1076891758 10:133288179-133288201 CCAGCTCCAGGAGCGCTTCCAGG 0: 1
1: 0
2: 5
3: 31
4: 293
Right 1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG 0: 1
1: 0
2: 1
3: 9
4: 117
1076891761_1076891771 22 Left 1076891761 10:133288185-133288207 CCAGGAGCGCTTCCAGGCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG 0: 1
1: 0
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076891771 Original CRISPR TCCGGAGCTCCTCCTCCGCG AGG Exonic
900095961 1:940237-940259 GCCGGCGCCCCTCCCCCGCGCGG - Intronic
900237371 1:1599207-1599229 CCGGCAGGTCCTCCTCCGCGGGG + Exonic
900366756 1:2314770-2314792 TGCGGGGCTGCCCCTCCGCGTGG - Intergenic
900786778 1:4654690-4654712 CCCCGCGCGCCTCCTCCGCGCGG + Intergenic
900787080 1:4655777-4655799 CCCGGCGCGCCTCCTCCCCGGGG + Intronic
904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG + Intronic
908534634 1:65066696-65066718 TCCGGACCGCCGCCGCCGCGGGG + Intergenic
916174185 1:162023954-162023976 CCAGGTCCTCCTCCTCCGCGCGG - Intergenic
916587710 1:166163152-166163174 TCAGGAGCCCTTCCTCCCCGAGG + Intronic
918356636 1:183711054-183711076 TCCTGAGCTCCTGCTCCTGGAGG + Intronic
920367334 1:205455148-205455170 GCCAGAGCTCCTCCTCCAGGTGG + Intronic
922721411 1:227901970-227901992 TCCCGAGCTTCTCCACCGTGAGG - Intergenic
922992777 1:229929565-229929587 TCCAGAGCTCTCCCTCCGTGTGG - Intergenic
1063160164 10:3412976-3412998 TCCGGAGCTCCCCATCAGCTGGG + Intergenic
1064373444 10:14774443-14774465 TCTGGAGCTCCTTCTGCGCTTGG + Exonic
1070947892 10:80408457-80408479 CCCGGAGCTCCTCCCACGGGGGG + Intronic
1071579410 10:86756329-86756351 GTCGGGGCTGCTCCTCCGCGCGG - Intergenic
1076127102 10:127983870-127983892 TCCGGGGCTCCTCCACCTCCCGG + Intronic
1076749670 10:132536509-132536531 TCCGGAGTGCCTGCTCCGCATGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1081493143 11:43582209-43582231 TCCAAAGCTCCTTCTCTGCGGGG - Intronic
1081716262 11:45252561-45252583 TGGGGAGCTCCTCCTCCGCCAGG + Exonic
1084429133 11:69101678-69101700 GCAGGAGCTCCTCCTCCTCCTGG + Intergenic
1085011013 11:73141925-73141947 TCCGGCCCTCCTCCTCCTCCTGG - Exonic
1085465707 11:76721936-76721958 TGCGGAGCAGCTCCCCCGCGTGG - Intergenic
1085718135 11:78890772-78890794 TCAGGAGCTCCTCCACAGCTTGG + Intronic
1089839584 11:121403972-121403994 TCTGGAGCTCCTTCTCTGCATGG - Intergenic
1090204737 11:124878019-124878041 TCTGCAGCTCCTCCCCCGCTGGG - Exonic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1110443357 13:75549701-75549723 TTAGGCGCTCCTCCTCCGGGCGG + Intronic
1113945713 13:114043013-114043035 TCAGGAGCTCCTCTGCCTCGCGG + Intronic
1114516127 14:23301464-23301486 TCCGGAGCTCCGCCACTGCCCGG + Exonic
1116950147 14:50872064-50872086 GCCCGCCCTCCTCCTCCGCGCGG - Intronic
1122144957 14:99683742-99683764 CCCGGGGCGCCTCCTCCGCCCGG - Intergenic
1123895857 15:24829320-24829342 TCCAAAGCTCCTCCTCCTGGAGG - Intronic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1130699784 15:86166629-86166651 TCCTGAGCTCCTCCTCCTGAAGG - Intronic
1131021453 15:89102710-89102732 TCAGGAGCTCTTCCTCCGCTGGG - Intronic
1136756421 16:32688822-32688844 GCGGGAGCTGCTGCTCCGCGAGG + Intergenic
1137584932 16:49658669-49658691 ACTGGAACTCCTCCTCCTCGTGG - Intronic
1138179181 16:54930806-54930828 CCCGAAGCTCCTCCTTCCCGGGG - Intergenic
1143599253 17:7933112-7933134 TCAGGAGATCCTCCGCCCCGAGG - Exonic
1143648491 17:8248042-8248064 GCCGGAGCTCCGCCCCCGGGAGG + Exonic
1146615673 17:34355638-34355660 TCCTGGGCTCCTCCTGCGAGGGG - Intergenic
1147919582 17:43907580-43907602 TCCGGACCTCCGCCCCCTCGCGG - Intronic
1152379563 17:79935308-79935330 TCCGGAGCTGCTCTTCCTCCTGG + Exonic
1152701447 17:81821853-81821875 TCCCCTGCTCCTCCTCCCCGGGG + Intergenic
1152757868 17:82094454-82094476 TCAGGAGGTCCTTCTCCGCCCGG + Intronic
1155209199 18:23586433-23586455 TCCTCCGCTCCTCCTGCGCGGGG - Exonic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1160362289 18:78294061-78294083 TCCAGAGCTGCTGCTCGGCGTGG + Intergenic
1160737574 19:671003-671025 GCCTGAACTCCTCCTCCGCAGGG - Intergenic
1161355814 19:3819151-3819173 CCAGGAGCTCCTGCTCCGTGGGG + Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161469105 19:4447579-4447601 TCCGGTACTTCTCCTCCTCGGGG + Exonic
1161735582 19:5990460-5990482 TCCCCAGCTCCTCCTCGGCCGGG - Intergenic
1163510825 19:17734020-17734042 GACGGAGCTCCTCCTCTGCAAGG - Intronic
1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG + Exonic
1164958321 19:32405724-32405746 TCCGGCGCGCCCCCTCCCCGGGG + Intronic
1166497088 19:43311382-43311404 TCCGGAGTTCTTCCTCCGAAAGG + Intergenic
1167078032 19:47260735-47260757 CCCCCAGCTCCTCCTCCTCGAGG - Exonic
927938236 2:27087143-27087165 GCCCTGGCTCCTCCTCCGCGTGG - Exonic
929107095 2:38376641-38376663 GCGCGACCTCCTCCTCCGCGGGG + Intronic
934054609 2:88241285-88241307 TCCTGGGCTCCTCCTCTGGGCGG - Intergenic
948001758 2:234573582-234573604 TCCTGAGCTTCCCCTCCTCGTGG + Intergenic
948694895 2:239728287-239728309 TCCAGCTCTCCTCCTCCTCGCGG + Intergenic
1176099771 20:63359652-63359674 TCAGGAGCCGCTCCTCGGCGTGG + Exonic
1176173816 20:63708314-63708336 TCCGGAGCCCCTTCCCCGCGGGG - Intronic
1179232734 21:39519664-39519686 CCCAGAGCGCCTCCTCCGCCTGG + Intergenic
1179411980 21:41168815-41168837 TTGTGAGCTCCCCCTCCGCGGGG + Intronic
1182442743 22:30373701-30373723 TCTGCAGCTGCTCCTCCACGCGG - Exonic
1183356860 22:37364326-37364348 TCCGGAGCCCCTCATCCCTGAGG - Intergenic
1183448685 22:37878036-37878058 TCCGGAACTCCTGCTCTGTGAGG - Exonic
1184387315 22:44183383-44183405 TTGAGAGCTCCTCCTCCGCTGGG - Exonic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
950097450 3:10338223-10338245 GCCGCAGCTCCCGCTCCGCGTGG + Exonic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
952484750 3:33798848-33798870 TGCTGAGCTCCTCCGCCGCGCGG - Exonic
953526071 3:43691072-43691094 TCCGGCGCGCACCCTCCGCGCGG + Intronic
954270068 3:49500850-49500872 TACAGAGATCCTCCTCCTCGTGG - Intronic
954861596 3:53695171-53695193 TCCCCAGCACCTCCTCCACGGGG - Intronic
967889911 3:194357649-194357671 CCTGGAGCTCCTCCTGCGTGTGG - Intronic
968377314 4:54016-54038 CCCTGTGCACCTCCTCCGCGTGG + Intronic
968384648 4:125194-125216 CCCTGTGCGCCTCCTCCGCGTGG + Exonic
968401796 4:304753-304775 CCCTGTGCGCCTCCTCCGCGTGG - Intronic
968405873 4:338527-338549 CCCTGTGCGCCTCCTCCGCGTGG + Intronic
968410640 4:386847-386869 CCCTGTGCGCCTCCTCCGCGTGG + Intergenic
968419644 4:473429-473451 CCCTGTGCGCCTCCTCCGCGTGG - Intronic
968646685 4:1744601-1744623 GCTGCAGCTTCTCCTCCGCGTGG - Exonic
969326507 4:6447402-6447424 TCCGGAGCTCTTCCTCCGCAGGG - Intronic
972543128 4:40056646-40056668 CCCCGAGCTCCGCCTCGGCGCGG - Intergenic
978126980 4:105146656-105146678 GCCGGCTCTCCTCCTCCGCCCGG - Exonic
980774522 4:137421253-137421275 TCCCGAGCCCCTGCCCCGCGGGG - Intergenic
986541140 5:8844895-8844917 TCCGGAAGTCCTCCTCTGGGAGG + Intergenic
999420419 5:151437043-151437065 TCCAGAGCTCTTCATCCGCCTGG + Intronic
1001200752 5:169714107-169714129 GCTGGAGCTCCTGCTCAGCGTGG - Exonic
1003188145 6:3850282-3850304 GCCGGTTCTCCTCCTCCTCGCGG - Exonic
1003625208 6:7735111-7735133 TCCGGGGCTCTGCCTCCGAGGGG - Intronic
1006337342 6:33427679-33427701 TCCTGGGCTCCTCCTCTGCTGGG + Intronic
1007511165 6:42375321-42375343 TCCGGAGCTGCTCCACAGAGCGG - Intronic
1007652582 6:43432580-43432602 TCAGGAGCCCCTCCTGCCCGAGG + Exonic
1009320773 6:62286035-62286057 CGCGCTGCTCCTCCTCCGCGCGG + Exonic
1016330486 6:142947434-142947456 CCCGGAGCGCCTCCTCCGGGTGG + Intergenic
1016433129 6:144008386-144008408 TCCCGAGCCCCGCCTGCGCGCGG - Intronic
1019700998 7:2475034-2475056 TCCGGGGACCCTCCTCCGCCTGG - Intronic
1024766684 7:52668649-52668671 TTAGGAGCTCCTCCTTGGCGCGG - Intergenic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1034589738 7:152129070-152129092 TCCGCAGCTCCCCCGCCGCCAGG - Intergenic
1041919823 8:63168942-63168964 CCCGGAGCTCCACCCTCGCGCGG + Intronic
1049360050 8:142208164-142208186 TCTGGAGCTCCTTCTCCCCCAGG + Intergenic
1053050511 9:34957893-34957915 TCCGGGCCGCCTCCTCCGGGCGG + Intronic
1053131328 9:35617393-35617415 TCCTGAGTTCCTCCTCTGCCCGG + Intronic
1056496437 9:87160059-87160081 TCAGGGGCTCTTCCTCCTCGTGG - Intergenic
1056532495 9:87498846-87498868 TCCGGAGCTGCCCCTCCTCGCGG - Intronic
1060842608 9:126805386-126805408 GGCGGAGCTCCGCCGCCGCGAGG - Intronic
1061216603 9:129225343-129225365 TGCTGAGCACCTCCTCCGCCTGG + Intergenic
1062039506 9:134397646-134397668 TCCTGAGCTCCTCCTCGCCTGGG + Intronic
1062461605 9:136664728-136664750 GCAGGAGCTGCTCCTCCGGGTGG - Exonic
1062574380 9:137199672-137199694 TCCGGGGCTCCTCCTCCTGAGGG - Exonic
1203571922 Un_KI270744v1:140230-140252 CCCTGTGCACCTCCTCCGCGTGG - Intergenic
1185455391 X:307829-307851 TCTGGAGCTCCGCCTCGGGGTGG + Exonic
1189286359 X:39854799-39854821 TCCAGAGCTCCTCCTTTGGGAGG + Intergenic
1192451793 X:71249511-71249533 CCCTGAGCTCCTCTTCCACGAGG - Exonic
1193802928 X:85958494-85958516 TCCGGGCCTCCTCCTCTGTGTGG + Intronic
1200216511 X:154370505-154370527 CCCGGGCCTCCTCCTCCTCGGGG + Intronic