ID: 1076891771

View in Genome Browser
Species Human (GRCh38)
Location 10:133288230-133288252
Sequence TCCGGAGCTCCTCCTCCGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076891761_1076891771 22 Left 1076891761 10:133288185-133288207 CCAGGAGCGCTTCCAGGCGAGGG 0: 1
1: 0
2: 1
3: 17
4: 148
Right 1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG 0: 1
1: 0
2: 1
3: 9
4: 117
1076891758_1076891771 28 Left 1076891758 10:133288179-133288201 CCAGCTCCAGGAGCGCTTCCAGG 0: 1
1: 0
2: 5
3: 31
4: 293
Right 1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG 0: 1
1: 0
2: 1
3: 9
4: 117
1076891765_1076891771 10 Left 1076891765 10:133288197-133288219 CCAGGCGAGGGGGCGTGATGTCC 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG 0: 1
1: 0
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076891771 Original CRISPR TCCGGAGCTCCTCCTCCGCG AGG Exonic