ID: 1076892925

View in Genome Browser
Species Human (GRCh38)
Location 10:133293615-133293637
Sequence CCTGATGGACAGGTCCAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076892917_1076892925 5 Left 1076892917 10:133293587-133293609 CCACTGGGAGGATCCTGTGCACC 0: 1
1: 1
2: 0
3: 18
4: 139
Right 1076892925 10:133293615-133293637 CCTGATGGACAGGTCCAGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 186
1076892918_1076892925 -8 Left 1076892918 10:133293600-133293622 CCTGTGCACCAGCTCCCTGATGG 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1076892925 10:133293615-133293637 CCTGATGGACAGGTCCAGGTTGG 0: 1
1: 0
2: 1
3: 18
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076892925 Original CRISPR CCTGATGGACAGGTCCAGGT TGG Exonic
900241189 1:1618355-1618377 GATGCTGGACAGGTCCAGGGTGG + Intronic
900576295 1:3384116-3384138 CCTGCTGGACAGGTGTATGTGGG - Intronic
900576303 1:3384152-3384174 CCTGCTGGACAGGTGCATATGGG - Intronic
903935654 1:26893128-26893150 TCTGATGGTCAGGCCCTGGTAGG - Intronic
905024526 1:34840590-34840612 GCTGTTGGACAGGTCTAGGAAGG - Intronic
911696053 1:100891608-100891630 ACTGGTTGGCAGGTCCAGGTGGG + Intronic
917855723 1:179097855-179097877 ACTGGTTGGCAGGTCCAGGTGGG - Intronic
918076066 1:181172610-181172632 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
918225019 1:182473578-182473600 CCAGATGGAGAGGTTCAGGAGGG - Exonic
918394715 1:184101798-184101820 CCTGAGAGAGAGGTCCAGGCAGG - Intergenic
919755130 1:201061896-201061918 CCTCATGGACATGGTCAGGTAGG - Intronic
919953700 1:202390950-202390972 GCTGCTGGAGAGGTTCAGGTGGG + Intronic
922273230 1:224053624-224053646 CCTGATGTACAGCCCCAGGAAGG + Intergenic
1067058883 10:43067651-43067673 CCTGAGGGCCAGGCCCAGGGAGG + Intergenic
1067087784 10:43252029-43252051 CCTCATGGCCAGGGCCAGGTGGG - Intronic
1068600507 10:58951728-58951750 GCTAATGAACAGGTCCAGGCTGG - Intergenic
1069735684 10:70652614-70652636 GCTGATAGAGAGCTCCAGGTGGG + Intergenic
1069769845 10:70891266-70891288 CCTGATGGACAGCGGCATGTTGG + Intergenic
1070250712 10:74770630-74770652 ACTGATTGGCAGGTCCAGGTGGG + Intergenic
1071604189 10:86973240-86973262 CCTGGAGGGCAGGGCCAGGTGGG + Intronic
1075711355 10:124532402-124532424 GCTTTTGGGCAGGTCCAGGTGGG - Intronic
1076639892 10:131907918-131907940 TCTGATGGGAAGTTCCAGGTTGG + Intronic
1076892925 10:133293615-133293637 CCTGATGGACAGGTCCAGGTTGG + Exonic
1077085141 11:746466-746488 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
1077105020 11:838433-838455 CCTGGTGGTCAGATGCAGGTTGG + Exonic
1077506121 11:2930706-2930728 CCTGAAGGGCAGGTGGAGGTAGG - Intergenic
1078827378 11:14942073-14942095 ACTGGTTGGCAGGTCCAGGTGGG + Intronic
1080028771 11:27638710-27638732 ACTGGTTGGCAGGTCCAGGTGGG + Intergenic
1081771829 11:45654902-45654924 GCTGAGTGACAGATCCAGGTAGG - Intronic
1081866899 11:46365143-46365165 CATGGAGGCCAGGTCCAGGTGGG + Intronic
1082799457 11:57403884-57403906 CCTGATGGAAGGGCCCAGCTTGG + Intronic
1084800410 11:71539835-71539857 CCTGAAGCAGAGGTCTAGGTAGG - Intronic
1085774548 11:79353375-79353397 CCTGATGGTCAAGTCCAGGAAGG + Intronic
1086782103 11:90920176-90920198 CTGGATGGACAGGAGCAGGTAGG + Intergenic
1088691481 11:112332179-112332201 CCTTATGGATAGGTGCAGGATGG + Intergenic
1088739250 11:112753353-112753375 ACTGATGGCCAGGTTCAGCTTGG - Intergenic
1090469135 11:126963917-126963939 CGTTATGGACAAGTGCAGGTGGG - Intronic
1091223840 11:133946258-133946280 CCTGATGGGGACGGCCAGGTTGG + Exonic
1091597127 12:1885650-1885672 CATAATGGAAAGGTCCAGGTGGG + Intronic
1100159987 12:91846815-91846837 CCTTAAGGACAGCTGCAGGTGGG - Intergenic
1102812713 12:115838128-115838150 CCTGGTGGACAGGTAGAGGGCGG + Intergenic
1108633709 13:52311931-52311953 CGTGATGGAGAGATCCAGGAAGG - Intergenic
1108634120 13:52315632-52315654 CATGATGGAGAGATCCAGGAGGG - Intergenic
1109300901 13:60589173-60589195 CCTGGTTGGCAGGTCCAGGTGGG - Intergenic
1109470020 13:62791825-62791847 ACTGGTTGGCAGGTCCAGGTGGG + Intergenic
1109594377 13:64530767-64530789 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
1111607575 13:90561086-90561108 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
1117445563 14:55800786-55800808 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
1121351163 14:93174188-93174210 CCCGGTGGACAGGCCCACGTGGG + Intergenic
1123147198 14:106143319-106143341 TCTGAGGGAAAGGTCCATGTGGG + Intergenic
1130036420 15:80365524-80365546 CCTGCTGGGCAGGTGCAGGAGGG + Intronic
1130240573 15:82184553-82184575 CCTGCTGGGAAGGTACAGGTGGG - Intronic
1130701637 15:86189274-86189296 CCTGATGGACAGGCCCAAGCTGG + Intronic
1131094433 15:89646774-89646796 CCTGCTGGACTGGTCAAGTTCGG - Intronic
1131875546 15:96802390-96802412 TCTGTTGTACAGTTCCAGGTAGG - Intergenic
1133945184 16:10342016-10342038 CATGAGTCACAGGTCCAGGTAGG - Intronic
1134604498 16:15559709-15559731 CCTGATGGACAGCTTGGGGTCGG + Intronic
1136691738 16:32037753-32037775 TCTGAGGGAAAGGTCCACGTGGG - Intergenic
1136792325 16:32981316-32981338 TCTGAGGGAAAGGTCCACGTGGG - Intergenic
1136877491 16:33872592-33872614 TCTGAGGGAAAGGTCCACGTGGG + Intergenic
1137746400 16:50823363-50823385 GCTGTTGTTCAGGTCCAGGTTGG + Intergenic
1139014825 16:62677476-62677498 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
1139373688 16:66483841-66483863 CCTGCTGGACAGGCCAAGGCTGG + Intronic
1139938231 16:70586686-70586708 GCTGGAGGACAGGTCCAGGACGG - Intronic
1139966027 16:70745863-70745885 CCTGATGGGCAGGGCCATGTGGG + Intronic
1141601099 16:85126884-85126906 CAAGACGGACAGGGCCAGGTGGG - Intergenic
1142401271 16:89860030-89860052 GCTGAGGCACAGCTCCAGGTGGG - Intronic
1203094532 16_KI270728v1_random:1242780-1242802 TCTGAGGGAAAGGTCCACGTGGG - Intergenic
1143052756 17:4140145-4140167 CCTTATGAAAATGTCCAGGTAGG - Intronic
1143781785 17:9233034-9233056 CCTGTTGGGCCGGTCCAGCTAGG - Intronic
1144481033 17:15629077-15629099 CCTGCTGGGGAGGTCCGGGTAGG + Exonic
1144917332 17:18734976-18734998 CCTGCTGGGGAGGTCCGGGTAGG - Exonic
1145817451 17:27805753-27805775 CAGGATGGACAGGCCCAGGGTGG + Intronic
1146454943 17:33002089-33002111 CCTGAAGGACATGCTCAGGTTGG + Intergenic
1146692761 17:34888054-34888076 CCTGATTGACAGGCCCTAGTGGG + Intergenic
1148648732 17:49234358-49234380 ACTGGTTGGCAGGTCCAGGTGGG + Intergenic
1152183779 17:78841256-78841278 CCTGACGGCCAGGGGCAGGTGGG - Intronic
1152560365 17:81075637-81075659 GCTGGTGGACAGGTGGAGGTAGG - Intronic
1158023630 18:52870658-52870680 ACTGATTGGCAGGTCAAGGTGGG - Intronic
1160953532 19:1679129-1679151 CCTGAGGGGCTGGTCCTGGTTGG - Intergenic
1161539165 19:4839342-4839364 GCTGCTGGACAGGTCCTGGAAGG + Exonic
1161953222 19:7478969-7478991 CCTGGTGGACTGGCCCGGGTGGG - Intronic
1163695647 19:18762008-18762030 CCAGATAGACAGGGCCAGGCAGG + Intronic
1163699459 19:18780118-18780140 CCTGAGGGGCAGGCCCACGTGGG + Exonic
1164099597 19:22043117-22043139 CCTGATGGAAGGGACCAGGCAGG + Intergenic
1164577319 19:29413168-29413190 CCAGGAGGACAGGCCCAGGTTGG + Intergenic
1164616401 19:29669182-29669204 TCTGCTGGACGGGTCCAGGGTGG + Intronic
1165968516 19:39605041-39605063 ACTGATGGCCAGGTCCCTGTGGG - Intronic
1166121391 19:40689664-40689686 CCTGAGGGCCAGGTCCAGGAGGG + Intronic
1168562363 19:57395008-57395030 CCTGATGGAGGAGTTCAGGTTGG + Intronic
925331617 2:3063031-3063053 CCTCAAGGAGAGGGCCAGGTGGG + Intergenic
926684104 2:15685271-15685293 CCTGGTGGACAGGTTCTGGTTGG - Intergenic
926752315 2:16207818-16207840 ACTGGTTGGCAGGTCCAGGTGGG + Intergenic
926889588 2:17627645-17627667 ACTGGTTGGCAGGTCCAGGTGGG + Intronic
928671817 2:33610598-33610620 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
936267875 2:111023989-111024011 CCTGTTGAACAGGTCAAGGAGGG + Intronic
937672985 2:124558448-124558470 TCTGCTGGACAGCTCCACGTGGG - Intronic
937712826 2:124997384-124997406 CATGACTCACAGGTCCAGGTGGG + Intergenic
943607063 2:189988119-189988141 ACTGGTTGGCAGGTCCAGGTGGG + Intronic
946163581 2:217850211-217850233 CCTGAAGAACAGGCCAAGGTGGG + Intronic
947914501 2:233822745-233822767 ACTGAGGGAAAGGTCCAGGGAGG - Intronic
948477011 2:238226830-238226852 CCTGCAGGACAGGTAGAGGTTGG - Intronic
1171253570 20:23668858-23668880 CCTGCTGGACAGGCCCAGAACGG + Intergenic
1171260052 20:23724152-23724174 CCTGCTGGACAGGCCCAGAATGG + Intergenic
1171269123 20:23799685-23799707 CCTGCTGGACAGGCCCAGAATGG + Intergenic
1172020764 20:31912301-31912323 CCTGATTCACAGGTCTGGGTGGG + Intronic
1172563207 20:35907287-35907309 CCTGATGGACACCTGCAGCTTGG + Intronic
1172679837 20:36704895-36704917 CCCTCTGGACATGTCCAGGTGGG + Intronic
1173248778 20:41353706-41353728 CCAGAGGGGCAGGTGCAGGTTGG - Intronic
1173838351 20:46140116-46140138 CCTAATGGACAGAGCCAGGTGGG + Intergenic
1175256715 20:57652310-57652332 CCTGATGGATAGTGCCAGGCTGG - Exonic
1175851506 20:62096636-62096658 CCAGAGGGAGAGGTCGAGGTGGG - Intergenic
1175871497 20:62211496-62211518 CCTGGGTGCCAGGTCCAGGTGGG - Intergenic
1176106497 20:63392036-63392058 TCTGAGGGGAAGGTCCAGGTTGG + Intergenic
1178742728 21:35217668-35217690 CCTGAGGCACAAGTGCAGGTGGG + Intronic
1180921024 22:19521740-19521762 CCTGTTGTACAGGCCCAGGTGGG + Intergenic
1180971473 22:19818347-19818369 CCTGATGCACATGGCCTGGTGGG + Intronic
1182353508 22:29711632-29711654 CCTGGTAGGCAGGGCCAGGTGGG - Intergenic
1182766691 22:32762681-32762703 GCTGATGGACAGAGCGAGGTGGG + Intronic
1184234007 22:43173607-43173629 CCTTATGGACAGGTCCAGGCTGG - Intronic
1184981041 22:48096283-48096305 TGGGATGGACAGGTCCATGTGGG + Intergenic
951895404 3:27605479-27605501 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
952254439 3:31683390-31683412 CCAGGTGGGAAGGTCCAGGTGGG + Intronic
952566305 3:34662583-34662605 CCTGATGTTCAAGTCCAGATTGG + Intergenic
952832456 3:37576511-37576533 CCTGATGGAAAGGTTGAGGTGGG + Intronic
953041715 3:39261453-39261475 CCTGATTGAGAGGTCCACCTTGG - Intergenic
953181105 3:40596164-40596186 CCTGAAGGGCAGGTGCAGGCAGG + Intergenic
959603950 3:108222106-108222128 CCTGAAGGCCCCGTCCAGGTGGG - Exonic
960550348 3:118969435-118969457 CGTAAAGGACAGGTTCAGGTTGG + Intronic
960882036 3:122354958-122354980 AGTAATGGACAGGTCCTGGTTGG + Intergenic
961797597 3:129420945-129420967 CCCTATGGAGAGGTCCATGTGGG + Intronic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
962256034 3:133870962-133870984 CCTGTTGGTGAGGTCCAGGTAGG - Intronic
964921076 3:161896518-161896540 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
965796728 3:172448159-172448181 CATGCTGGACAGGTAGAGGTTGG + Exonic
966708705 3:182948159-182948181 CCTGATGTACACCTACAGGTTGG + Intronic
968764000 4:2458761-2458783 CCGGGAGGACAGGTCCAGGAAGG + Exonic
969028563 4:4193437-4193459 GCTGATGTGCATGTCCAGGTGGG - Intronic
972682095 4:41315929-41315951 CATGAGTCACAGGTCCAGGTGGG + Intergenic
980121472 4:128732322-128732344 ACTGGTTGGCAGGTCCAGGTGGG + Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
986178238 5:5369842-5369864 CCAACTGGACAGGTCTAGGTGGG + Intergenic
989480246 5:41922738-41922760 CCAGATGGAAAGGACCAGGATGG + Intergenic
991249080 5:64539640-64539662 CCTGGTGGTCAGGTCCCGGGAGG - Intronic
993617429 5:90131048-90131070 CCTGATGGAGAAGTCCCTGTAGG + Intergenic
995158475 5:108944946-108944968 TCTAATGGAGAGGTCCAGTTAGG - Intronic
998156613 5:139790356-139790378 TCAGGTGGAAAGGTCCAGGTTGG + Intergenic
999399879 5:151256401-151256423 CATGTTGGCCAGGTTCAGGTTGG - Intronic
999689423 5:154134040-154134062 CCTTTTGGACAATTCCAGGTGGG - Intronic
1000380981 5:160629148-160629170 CCAGATGGGCAGGTGCAGGAAGG + Intronic
1001306789 5:170580566-170580588 CCGGATGGTCATGTTCAGGTTGG + Intronic
1001591320 5:172867298-172867320 CCAGGTGGGCAGGTCCAGTTTGG + Intronic
1001833359 5:174808387-174808409 AGTGATGGAGAGGCCCAGGTTGG + Intergenic
1002788638 6:423256-423278 CCAGCCGGCCAGGTCCAGGTTGG - Intergenic
1006100697 6:31684354-31684376 CCTAATGGCCATGTCCAGGGAGG + Intergenic
1006929690 6:37680267-37680289 CCTGATGGGGAGGGCAAGGTGGG + Intronic
1010365646 6:75048586-75048608 CCTGATGGTCAATTCAAGGTTGG - Intergenic
1011049342 6:83127033-83127055 ACTGGTTGGCAGGTCCAGGTGGG + Intronic
1013430798 6:110053328-110053350 CCGAAGGGACTGGTCCAGGTTGG - Intergenic
1014681514 6:124436700-124436722 CCTGGTGGCCTGGACCAGGTTGG - Intronic
1016531362 6:145061128-145061150 CATGTAGGCCAGGTCCAGGTGGG - Intergenic
1017143534 6:151213509-151213531 CATGAGTCACAGGTCCAGGTTGG - Intergenic
1017940806 6:159051156-159051178 CCTGATGGACTAGTCCAGACTGG + Intergenic
1018816635 6:167337325-167337347 CCTCATGGACTGCTCCAGGGAGG + Intronic
1019374734 7:683393-683415 CCAGGTGCACCGGTCCAGGTGGG + Intronic
1020764748 7:12305649-12305671 ACTGGTTGGCAGGTCCAGGTGGG - Intergenic
1023526340 7:41107573-41107595 CCTGTTGGGCAGCTCCAGCTTGG + Intergenic
1025722145 7:64026773-64026795 CCTGTGGGAGAGGTCCAGGTAGG + Intergenic
1025750873 7:64293095-64293117 CCTGTGGGAGAGGTCCCGGTAGG + Intergenic
1029559659 7:101294180-101294202 TCTGGTTGACAAGTCCAGGTGGG + Intergenic
1031672362 7:124565003-124565025 CCTTATGGAAAGGCCCATGTGGG - Intergenic
1032200789 7:129821404-129821426 CCTGAAGGAGAAGTCCAGGGAGG + Intergenic
1032436019 7:131900923-131900945 CCTGAGGGAAAGGTTCAGGCTGG + Intergenic
1033067287 7:138168128-138168150 ACTGGTTGGCAGGTCCAGGTGGG + Intergenic
1034413757 7:150954630-150954652 GCTGGGGGACAGGTACAGGTAGG - Intronic
1034469301 7:151247107-151247129 CCTGAGTGACAGGGTCAGGTGGG - Intronic
1036660962 8:10708370-10708392 CCACATGGAGAGGTCCATGTGGG - Intronic
1036690353 8:10941130-10941152 CCTGTTGGACAGGGCCTGGAGGG - Intronic
1038280134 8:26156514-26156536 CATGATTCACAGGTCCAGGTGGG + Intergenic
1040598818 8:48864900-48864922 CCTGATGGCCTCGACCAGGTGGG - Intergenic
1041930334 8:63279895-63279917 GCTGGTGGACAGGACCAGGGTGG - Intergenic
1043090066 8:75890477-75890499 CAGTTTGGACAGGTCCAGGTGGG + Intergenic
1044987775 8:97770052-97770074 ACTGGTTGGCAGGTCCAGGTGGG + Intergenic
1047370451 8:124251893-124251915 TCTGATGGACATGTCCACCTTGG - Intergenic
1047692697 8:127372583-127372605 TCTGATGGAGAGGTCCATGTGGG - Intergenic
1049208507 8:141374586-141374608 CCAGATGGACAGACCCAGGTCGG - Intergenic
1049420784 8:142515639-142515661 CCAGCTGGACAGGGACAGGTGGG - Intronic
1049671948 8:143873825-143873847 CTGGAGTGACAGGTCCAGGTGGG - Intronic
1051452844 9:17216182-17216204 CCTGGGGGACAGTTCCAAGTTGG - Intronic
1053356689 9:37451855-37451877 ACTGGTTGGCAGGTCCAGGTGGG + Intronic
1054998855 9:71425568-71425590 CATGATGGCCTGGACCAGGTTGG - Intronic
1057193353 9:93099667-93099689 CCACATGGACAGGCCCAGCTGGG - Intronic
1058665345 9:107309189-107309211 TCTGATTTACAGGTCCAGGGTGG - Intronic
1060731488 9:126039677-126039699 CCAGAGGGACAGGACCAGGAAGG + Intergenic
1061079768 9:128362898-128362920 CATGATGGACAGGGACTGGTGGG + Intergenic
1061838452 9:133344061-133344083 CCTGCTGGCCAGGCCCAGGTAGG + Intronic
1062097090 9:134709125-134709147 CCCGAGGGATGGGTCCAGGTCGG - Intronic
1062285893 9:135772344-135772366 CCTGGTGGATGGGGCCAGGTGGG - Intronic
1187093246 X:16119492-16119514 CCTTATGGACAGATCCACATGGG - Intergenic
1189515845 X:41712833-41712855 ACTGGTTGGCAGGTCCAGGTGGG - Intronic
1190559624 X:51673981-51674003 CCTTATGGACAGCTCGGGGTTGG + Intergenic
1190564667 X:51719340-51719362 CCTTATGGACAGCTCGGGGTTGG - Intergenic
1191998330 X:67121037-67121059 CCTAATGGAGAAGTCTAGGTTGG + Intergenic
1192571417 X:72209301-72209323 CTTGAGGGACAGCTCTAGGTTGG - Intronic
1194994418 X:100576558-100576580 CCTCATGCACAAGTCAAGGTAGG - Intergenic
1201735298 Y:17253809-17253831 CATGGTGGACATGTCCAGATTGG - Intergenic