ID: 1076894292

View in Genome Browser
Species Human (GRCh38)
Location 10:133302330-133302352
Sequence GTGAGCGCCACCCCGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076894292_1076894300 7 Left 1076894292 10:133302330-133302352 CCTGACCCCGGGGTGGCGCTCAC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1076894300 10:133302360-133302382 CCCGCACAGCCCTGCACCAGAGG 0: 1
1: 0
2: 0
3: 26
4: 236
1076894292_1076894302 10 Left 1076894292 10:133302330-133302352 CCTGACCCCGGGGTGGCGCTCAC 0: 1
1: 0
2: 0
3: 4
4: 121
Right 1076894302 10:133302363-133302385 GCACAGCCCTGCACCAGAGGTGG 0: 1
1: 0
2: 0
3: 28
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076894292 Original CRISPR GTGAGCGCCACCCCGGGGTC AGG (reversed) Intronic
901678773 1:10901477-10901499 GAGGGCCCCACCCCGGGGTCAGG - Intergenic
901845626 1:11980414-11980436 GCGAGCGCCACCCCAGGGGGAGG - Exonic
902270986 1:15304904-15304926 GTGAGCGCCACCTGGTGGCCAGG + Intronic
902348738 1:15837543-15837565 GACCGCGCCAGCCCGGGGTCGGG + Intergenic
905885933 1:41491969-41491991 GTGTGGCCCACCCTGGGGTCTGG - Intergenic
906381160 1:45332895-45332917 GTGAGAGCCACCCTAGGGTAGGG - Intronic
908109152 1:60877527-60877549 GAGAGCCCCACCCCGGGTTTGGG + Intronic
924455821 1:244218223-244218245 GTCAGCACCACCCCTGGGTGAGG - Intergenic
924778386 1:247126751-247126773 GGCAGCGGCACCCCGGGCTCCGG + Intronic
924783272 1:247171669-247171691 GGCAGCGGCACCCCGGGCTCCGG - Intronic
1064022894 10:11823666-11823688 GGCAGCGACGCCCCGGGGTCGGG - Intronic
1065489710 10:26270492-26270514 GTTACTGACACCCCGGGGTCTGG - Intronic
1076237049 10:128871564-128871586 GAGAGTGCCACTCGGGGGTCAGG + Intergenic
1076894292 10:133302330-133302352 GTGAGCGCCACCCCGGGGTCAGG - Intronic
1076894304 10:133302370-133302392 GTGAGCGCCACCTCTGGTGCAGG - Intronic
1076894311 10:133302400-133302422 GTGAGCGCCACCTCTGGTGCAGG - Intronic
1076894318 10:133302430-133302452 GTGAGCGCCACCTCTGGTGCAGG - Intronic
1076894327 10:133302460-133302482 GTGAGCGCCACCTCTGGTGCAGG - Intronic
1076894336 10:133302490-133302512 ATGAGCACCGCCCCTGGGTCAGG - Intronic
1076894382 10:133302674-133302696 GTGAGCGCCGTTCCTGGGTCAGG - Intronic
1080584835 11:33672393-33672415 GGGTGAGCCACCCTGGGGTCAGG + Exonic
1080806042 11:35654878-35654900 ATGAGCACCACCCAGGGGTTAGG + Intergenic
1083638406 11:64132553-64132575 GTCAGCGGCTCCTCGGGGTCTGG + Intronic
1083781439 11:64920258-64920280 GTGAGGGAGACCCCAGGGTCAGG + Intronic
1084621061 11:70270635-70270657 GTCAGCACCGCCCCGGGGGCGGG - Intergenic
1085534257 11:77208610-77208632 GTGAGGGCCTCCTCTGGGTCTGG + Intronic
1087254209 11:95936382-95936404 GAGAGAGCCACGCCGGGGTAGGG - Intergenic
1089621974 11:119727660-119727682 ACCAGGGCCACCCCGGGGTCGGG + Intronic
1094040073 12:26113363-26113385 GTGAGTGCCACCCTGGAGACAGG - Intergenic
1096695314 12:53344982-53345004 GGGAGCGCCAGCCCGGGGGAGGG + Intronic
1104649921 12:130524084-130524106 GGGAGCACCACCCCGGCATCTGG - Intronic
1104901424 12:132191288-132191310 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG + Intergenic
1112545468 13:100364901-100364923 GTGTGCGCCACCACCAGGTCTGG - Intronic
1113841886 13:113365208-113365230 GCGAGCGCCACCCAGGAGCCTGG + Intergenic
1113939155 13:114009723-114009745 GTGAGGGACAGCCCGGGGCCAGG - Intronic
1122887038 14:104714754-104714776 GTGACCGACTCCTCGGGGTCGGG + Exonic
1124640175 15:31392070-31392092 GAGACCGCGACCCGGGGGTCGGG - Intronic
1125529884 15:40406097-40406119 GGGAGCGCCAGCGCGGGGGCGGG + Intronic
1125769288 15:42154299-42154321 GTGAGGGCCAGCCAGGGGCCAGG - Intronic
1129468807 15:75738835-75738857 GTAGGCGCCACCCCGGGATGGGG + Intergenic
1132658607 16:1051738-1051760 GAGATCGGCCCCCCGGGGTCTGG + Intergenic
1133119258 16:3596188-3596210 CTGAGCGCCAGCCCGTGGCCCGG - Exonic
1133464895 16:6019649-6019671 GTGGGCCCCGCCCCGGCGTCCGG + Intronic
1136535486 16:30896744-30896766 GTTTCCGCCACCCCCGGGTCCGG + Intronic
1136773717 16:32860404-32860426 GTGAGGGCCAAGGCGGGGTCAGG - Intergenic
1136896895 16:34001115-34001137 GTGAGGGCCAAGGCGGGGTCAGG + Intergenic
1141631755 16:85291673-85291695 GGGAGGGTCTCCCCGGGGTCAGG - Intergenic
1141830263 16:86506350-86506372 CTGAGCCTCACCCCGTGGTCAGG + Intergenic
1142341345 16:89524850-89524872 GTGTGGCCCACCCCCGGGTCTGG + Intronic
1203076135 16_KI270728v1_random:1122515-1122537 GTGAGGGCCAAGGCGGGGTCAGG - Intergenic
1143480553 17:7225458-7225480 GTCAGCGGTACCCCGGGGTTAGG - Exonic
1143778816 17:9218645-9218667 GTAAGCCCCACCCCGGGGGTGGG - Intronic
1144637572 17:16920098-16920120 GAGGGCGCCACCCTGGGGCCAGG - Intergenic
1152641718 17:81452150-81452172 GTGGGCGCCTCCCGGGGGTGGGG - Intronic
1152793067 17:82292616-82292638 CTGCGCTCCTCCCCGGGGTCTGG - Intergenic
1152887611 17:82861540-82861562 GTGCGCGGCACACCGGGGCCGGG - Intronic
1157557061 18:48619746-48619768 GTGAGCGCGGGCCCGGGGTTGGG + Intronic
1160159958 18:76463568-76463590 GCGAGAGCCACCCAGGGGCCTGG - Intronic
1160842824 19:1154161-1154183 GTGAGCCCCACCCCCGGCCCCGG - Intronic
1160994388 19:1875982-1876004 GTGGGGGCCGCCGCGGGGTCGGG - Intergenic
1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG + Intergenic
1161485813 19:4535118-4535140 GGGAGCGCCCCCCCGGGCTTAGG - Intronic
1161982465 19:7637187-7637209 GTGAGTGCCTCTCCGGGGCCGGG + Intronic
1162362819 19:10230174-10230196 GTGCGGGCCAGCACGGGGTCGGG - Intronic
1162371824 19:10284364-10284386 GTGAGCCCCGCCCCGGGTTCAGG - Intronic
1162792336 19:13069565-13069587 GGCAGAGCCACCCCGGGCTCAGG + Intronic
1163632800 19:18425753-18425775 GTGAAGGCCACCCCAGGGGCAGG - Intronic
1165665259 19:37622323-37622345 GAGAGTGCCATCCAGGGGTCTGG + Intronic
1166383644 19:42368741-42368763 CTGAGCCCCACCTCTGGGTCTGG - Intronic
1167017533 19:46850734-46850756 GGGAGCGCTACGCCGGGGACTGG - Intronic
1167333803 19:48872619-48872641 CTGCGCGTCACCCCGGGGGCAGG - Exonic
1167506440 19:49873376-49873398 GTGAGTGCCATCCAGGGGACGGG - Intronic
926914603 2:17879510-17879532 GGAAGGGTCACCCCGGGGTCAGG + Intronic
927863239 2:26573517-26573539 CTGGGCGCCACTCCTGGGTCTGG - Intronic
929487973 2:42371867-42371889 CTGAGCGCCATCCCTGGGCCTGG + Intronic
929808655 2:45169902-45169924 GCGACCGCCACCGCGGGGTGGGG - Intergenic
932403022 2:71495220-71495242 GTGAGCACCACTCATGGGTCAGG - Intronic
946219958 2:218217545-218217567 GTGAGCGCGCGCCCGGGGCCGGG + Intronic
948588655 2:239036129-239036151 GTGAGAGGCAGCCAGGGGTCAGG + Intergenic
1172044625 20:32071557-32071579 GTGGGAGCCAGCCCGGGGGCAGG + Intronic
1176384569 21:6132448-6132470 GTGCCAGCCGCCCCGGGGTCAGG + Intergenic
1179738903 21:43405804-43405826 GTGCCAGCCGCCCCGGGGTCAGG - Intergenic
1181355044 22:22292343-22292365 GTGAGGGCCAAGGCGGGGTCAGG + Intergenic
1181471774 22:23145198-23145220 GTCAGCCCCACCCAGGGCTCAGG + Intergenic
1181529761 22:23510740-23510762 CTGAGCTCCACCCGGGAGTCAGG + Intergenic
1183075930 22:35426701-35426723 GGGAGCACCTCCCCGGGGCCAGG - Intergenic
1183294005 22:37019405-37019427 GCGAGCGCCAGCGCGGCGTCCGG - Exonic
1184176946 22:42794025-42794047 GTGAGCGGCAACCCGGGGCTGGG + Intergenic
1184679248 22:46061584-46061606 AAGGGCGCGACCCCGGGGTCAGG - Intronic
950199928 3:11035600-11035622 GAGAGCGCTTCCCCTGGGTCTGG - Intronic
952889295 3:38029929-38029951 GTGGGCGCCTCGCTGGGGTCGGG + Intergenic
955234883 3:57130677-57130699 GTGAGTGTCACCCCTGGGCCGGG - Intronic
957855375 3:85869802-85869824 GTGCCCGCCACCACGGGGCCTGG + Intronic
964438165 3:156675170-156675192 GTGCCCTCCCCCCCGGGGTCTGG - Exonic
968448678 4:665052-665074 CTGAGGGCCACCTCGGGGCCAGG + Intronic
983334954 4:166379319-166379341 GTGGGCACCAGCCTGGGGTCTGG + Intergenic
985509646 5:305587-305609 GTGAGCTGCACCCCAGGGTAAGG - Intronic
993898840 5:93570981-93571003 GGGAGCGCCCTTCCGGGGTCAGG + Intergenic
1001045139 5:168365653-168365675 GGGAGAGCCACCCCGGGGGCTGG - Intronic
1002301940 5:178262322-178262344 TAGAGCCCCAGCCCGGGGTCTGG - Intronic
1010725647 6:79329356-79329378 GTGAGGGCTTCCCCTGGGTCTGG - Intergenic
1015820868 6:137259088-137259110 GTGAGCCCCACCCAGGACTCTGG - Intergenic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019525412 7:1478404-1478426 GTCATCGCCACCCTGAGGTCTGG - Exonic
1019941824 7:4298049-4298071 CAGAGCCCCACCCGGGGGTCAGG + Intergenic
1029302753 7:99598216-99598238 GTGGGCTCCTCCCCCGGGTCGGG + Intronic
1029945331 7:104527061-104527083 GTGAGAGCCACACAGAGGTCTGG + Intronic
1033477075 7:141701863-141701885 GTGAGGGCCGCGCCGGGGCCAGG - Intronic
1036823540 8:11958371-11958393 ATGAGCGCCACCTTGGGGTTGGG + Intergenic
1038644947 8:29353074-29353096 GTGAGCGCCAGGCGCGGGTCCGG - Intergenic
1039757861 8:40542282-40542304 GTGTGGGCCACCGAGGGGTCAGG + Intronic
1042965820 8:74350692-74350714 GGGAGCGCCTGCCCGGGGTCAGG - Intronic
1043139822 8:76574229-76574251 TGGAGCACCTCCCCGGGGTCAGG - Intergenic
1048967385 8:139624675-139624697 GGCAGCCCCACCCAGGGGTCTGG + Intronic
1053691683 9:40590043-40590065 GTGAGGGCCAAGACGGGGTCAGG - Intergenic
1054273118 9:63047442-63047464 GTGAGGGCCAAGACGGGGTCAGG + Intergenic
1054302940 9:63391009-63391031 GTGAGGGCCAAGACGGGGTCAGG - Intergenic
1054401721 9:64717525-64717547 GTGAGGGCCAAGACGGGGTCAGG - Intergenic
1054435324 9:65201834-65201856 GTGAGGGCCAAGACGGGGTCAGG - Intergenic
1054495066 9:65819847-65819869 GTGAGGGCCAAGACGGGGTCAGG + Intergenic
1055654054 9:78436203-78436225 TTGAGTGCCTCCCTGGGGTCAGG + Intergenic
1057441255 9:95085312-95085334 GTGAGCGCGACCACGGTTTCTGG - Intronic
1060300287 9:122371092-122371114 GTGAGTGCGACCCCGGTGCCCGG + Intronic
1061662058 9:132136771-132136793 GTGACCCCCACGCTGGGGTCAGG + Intergenic
1190365964 X:49695421-49695443 GTGAGCGCCCCCCAGCGGTGTGG - Intronic