ID: 1076894416

View in Genome Browser
Species Human (GRCh38)
Location 10:133302834-133302856
Sequence TTGACCTGCTTCAAAAGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076894416_1076894422 18 Left 1076894416 10:133302834-133302856 CCTGTTCTTTTGAAGCAGGTCAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1076894422 10:133302875-133302897 CTCCTCCGTGGACACGCAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 128
1076894416_1076894418 6 Left 1076894416 10:133302834-133302856 CCTGTTCTTTTGAAGCAGGTCAA 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1076894418 10:133302863-133302885 CCTCAGCCCCATCTCCTCCGTGG 0: 1
1: 0
2: 2
3: 42
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076894416 Original CRISPR TTGACCTGCTTCAAAAGAAC AGG (reversed) Exonic
903307327 1:22422397-22422419 TTGTACTGGTGCAAAAGAACTGG - Intergenic
904612090 1:31731401-31731423 TTGACCTCCTTGAACAGCACTGG + Exonic
908474458 1:64473834-64473856 TTGAAATGCTGCAAAACAACAGG - Intronic
910059433 1:83070734-83070756 TTAACTTGCTGCCAAAGAACTGG - Intergenic
910357318 1:86375095-86375117 TAGAACTACTTCAAAAGAAATGG + Intronic
910920573 1:92342123-92342145 TTTCCCTGCTTCAAAGGAAAAGG - Intronic
911717080 1:101145228-101145250 TTGACCTGCATCTTAAGAACGGG + Intergenic
919548417 1:198952674-198952696 TTTACCTCCCTCGAAAGAACAGG - Intergenic
924080300 1:240389041-240389063 TTGACATGATTCAAATGATCAGG - Intronic
924728002 1:246687707-246687729 TTGGCCTGCTACAAAAAAGCAGG + Intergenic
1068917449 10:62447615-62447637 TTGACCGTCTTCAGAACAACAGG - Intronic
1071911805 10:90244589-90244611 TTGACCTGGTTGGAAAGAAGAGG - Intergenic
1075053368 10:119199736-119199758 TTGAGCTGCTCCAAACCAACTGG + Intergenic
1076894416 10:133302834-133302856 TTGACCTGCTTCAAAAGAACAGG - Exonic
1088600928 11:111474309-111474331 ATAAGCTGCTTCTAAAGAACTGG - Intronic
1092797075 12:12122505-12122527 TTGGCTTGCTTCAAAAGAAATGG + Intronic
1096177391 12:49531733-49531755 CTGACCTTCTCCAAGAGAACGGG - Intergenic
1100390964 12:94146550-94146572 TTCACCTGCTCCAAAATATCTGG - Intergenic
1101205050 12:102478513-102478535 CTGACCTGCTGTAAAAGACCTGG - Intronic
1103185589 12:118954479-118954501 GTGACTTGCTTCTAATGAACAGG - Intergenic
1109050927 13:57480144-57480166 TAGACGTGCCTCAAAAGAAAAGG + Intergenic
1109287917 13:60433869-60433891 TTTACCTGCTTTCAAAGAAATGG + Intronic
1111696544 13:91631646-91631668 TTGTCCTGCTTGCAAAGAAAGGG - Intronic
1112057746 13:95706513-95706535 TTGACAGGCTCCAGAAGAACAGG - Intronic
1117165335 14:53027422-53027444 TTGAGCTGCACCAATAGAACAGG + Intergenic
1119935894 14:78592311-78592333 TTGGCCTGATGCAAAAGAAGAGG + Intronic
1120325407 14:83018446-83018468 TGGACCTGCTGCAACAGAATGGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123883588 15:24699538-24699560 TTGATGTGTTTGAAAAGAACTGG + Intergenic
1124138110 15:27052722-27052744 TTAACCTGGATCAAAAGAAGAGG + Intronic
1128396436 15:67230810-67230832 TTGAACTGCTGCAAAAGCTCTGG + Intronic
1128594216 15:68929911-68929933 TTGACCTTCTTAAAAAGATAGGG - Intronic
1132245771 15:100295111-100295133 TTGACCTTCTTAAAAAGCATGGG + Intronic
1132702737 16:1229027-1229049 TTCACCTGCTTCAGAGGAAATGG + Exonic
1132705589 16:1241841-1241863 TTCACCTGCTTCAGAGGAAATGG - Exonic
1134871810 16:17658704-17658726 TTGACCTGCTACAAATGTTCCGG - Intergenic
1135102651 16:19620189-19620211 TTTACCCACTTCAAAAGTACAGG - Intronic
1139452661 16:67043115-67043137 GTGACCAGCTTCTAATGAACAGG - Intronic
1140848477 16:78912218-78912240 AGGACATGCTTCAAAACAACTGG - Intronic
1142732669 17:1871959-1871981 TGCTCCTGCTTCAAAGGAACAGG - Intronic
1144094598 17:11888665-11888687 TTAACCTGCTTTTAAAGATCAGG - Intronic
1148643093 17:49202823-49202845 TTGACCTGCCACCAGAGAACTGG - Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1155005188 18:21722689-21722711 TTGACATGCTTGAAGAAAACTGG + Intronic
1155765669 18:29629471-29629493 TTGCCCTGCTTCAGAATCACTGG - Intergenic
1156544041 18:37945984-37946006 TTGACCTGCTAAAAAGGAAGAGG + Intergenic
1162637197 19:11978727-11978749 TTTATGTGCTTGAAAAGAACTGG - Exonic
1166985095 19:46654895-46654917 TTGACCTTCCTCAAATAAACAGG - Intronic
925899809 2:8500776-8500798 TTGACCTGAGTCACTAGAACTGG + Intergenic
929513422 2:42584296-42584318 TTGACGTGCTTCAAAATAATGGG - Intronic
931700955 2:64908738-64908760 TTGAGCTGCTTAAGAAGACCTGG + Intergenic
931957917 2:67449470-67449492 ATGACCTGCTTCAAAAGAGAGGG - Intergenic
933366907 2:81364454-81364476 TTTCCCTGCCTAAAAAGAACTGG + Intergenic
939600171 2:144178886-144178908 TTGACCTGCTTCATACCAAAAGG + Intronic
939626455 2:144483511-144483533 TTGATCTTCTTCAAAAGTAAAGG - Intronic
941467519 2:165846823-165846845 ATGACCTTTTTCAGAAGAACTGG - Intergenic
942909591 2:181227080-181227102 ATGACCTGCTTCAAAAAAGAAGG - Intergenic
943339592 2:186663582-186663604 CTGACCTGCTTAAAAATAAGTGG + Intronic
944869767 2:203898291-203898313 TTGGCCAACTCCAAAAGAACAGG + Intergenic
946688782 2:222295650-222295672 GTCACCTGCTTTAAGAGAACAGG + Exonic
1174487107 20:50868261-50868283 GTGACCTGCTTTCAAAGAGCAGG - Intronic
1175723392 20:61300873-61300895 TTGAACTGCTCCAAAAGGAAGGG - Intronic
1176905890 21:14500869-14500891 TTCACTTGCTTCAAAAGTTCAGG + Intronic
1177861886 21:26463993-26464015 GTGTCCTGATTCTAAAGAACAGG + Intergenic
1178126795 21:29524854-29524876 GTGACCTACTTCCAAAGAGCAGG - Intronic
1178253289 21:31025276-31025298 TTGTCCTGCTACAAACCAACTGG + Intergenic
1178818579 21:35954185-35954207 TTGATGAGCTTCAAAGGAACGGG - Intronic
1180585541 22:16885597-16885619 ATGACTTGTTTCAAAAGGACAGG - Intergenic
1182071469 22:27466711-27466733 TTGGCTGGCTTCAAAAGAGCAGG + Intergenic
1182092370 22:27604531-27604553 TTGCCCAGTTTCAAAAGAATGGG - Intergenic
1182408004 22:30154669-30154691 TTGACATGTTTTAATAGAACAGG + Intronic
1183518957 22:38285226-38285248 TTGACCTGGGACAAAAGAAGGGG - Intergenic
1184874915 22:47268253-47268275 TTGAGATGCTTCCAAGGAACGGG + Intergenic
949781021 3:7688522-7688544 TAGAACTGCTTCAAAATAATTGG + Intronic
954976313 3:54698348-54698370 TTGAACTTTTTCAAAAGAGCTGG + Intronic
959044364 3:101455740-101455762 GTGACTTGGTTCAAAACAACAGG - Intronic
959139809 3:102472224-102472246 TTGACCGGCTTAAAAATGACTGG + Intronic
960334916 3:116405123-116405145 TTGAAAAGATTCAAAAGAACAGG + Intronic
971041432 4:22756908-22756930 CATACCTGCTTCACAAGAACAGG + Intergenic
971970695 4:33616560-33616582 CTGACTTTCTTCACAAGAACTGG + Intergenic
974410951 4:61539977-61539999 TTGATCTTCTTCTTAAGAACTGG + Intronic
978108917 4:104938020-104938042 TTTACCTGCTGCAAAACATCTGG - Intergenic
979456447 4:120930808-120930830 ATGACCTGCTTCAAGAGAGAAGG + Intergenic
980443633 4:132880022-132880044 TGGAGCTTCCTCAAAAGAACTGG + Intergenic
980780653 4:137487032-137487054 TTGTCCTGCTACAAAGGAACTGG + Intergenic
986745971 5:10745443-10745465 TCGGCCTGCTTCAAAATATCTGG + Intronic
987500919 5:18708519-18708541 CTGACTTTCTTCAAAAGAATTGG + Intergenic
987659930 5:20859235-20859257 TTGATGAGCTTCATAAGAACGGG - Intergenic
989245762 5:39252525-39252547 TTGACCTTTTTAAAAAGAATTGG - Intronic
991220641 5:64211501-64211523 TTGACCTGCTTCAGGCGAAAAGG + Intronic
991302688 5:65144621-65144643 TTGACCTATTTCAACATAACTGG - Intergenic
993836153 5:92822567-92822589 TGGAGCTGCTTTAAAAGAAATGG + Intergenic
997653763 5:135540380-135540402 TTGACCTGCTTCAAGAGCTGAGG - Intergenic
1004290819 6:14365309-14365331 ATGATCTGCTTCAAAAGAGAAGG + Intergenic
1005341006 6:24843826-24843848 TTGACATTTTTCAAAAGAAAAGG + Intronic
1006035901 6:31211934-31211956 TTGAAATGCTACAAAAGAACTGG + Intergenic
1007202964 6:40126154-40126176 CTGACTGGCTTCAAAAGGACAGG - Intergenic
1009040811 6:58174779-58174801 ATGACTGGCTTCAAAAAAACAGG - Intergenic
1009216666 6:60929312-60929334 ATGACTGGCTTCAAAAAAACAGG - Intergenic
1009520549 6:64677001-64677023 TTGAACTGTTTCAAAACAAGCGG + Intronic
1013004650 6:106060978-106061000 GTCATGTGCTTCAAAAGAACTGG + Intergenic
1017804089 6:157928149-157928171 TTGACATCCTTAGAAAGAACTGG + Intronic
1019356231 7:580990-581012 TTGACCAGCTTCCTAAAAACAGG + Intronic
1019990647 7:4688182-4688204 GTGATTTGCTTCTAAAGAACTGG - Intronic
1026219743 7:68383662-68383684 ATGAACTGCTTCAAAATTACTGG - Intergenic
1026298032 7:69072944-69072966 ATGACATGCTTCATAAAAACTGG - Intergenic
1027671718 7:81107504-81107526 TTTACCTGCTGAAAAAGAATGGG + Intergenic
1027970996 7:85081552-85081574 TTGGCCTGCTGCAAAGGAACGGG - Exonic
1031046636 7:116896536-116896558 TTGAGCTGTTTTAAATGAACAGG + Intronic
1031048225 7:116918235-116918257 TTGACCCCATTAAAAAGAACTGG - Exonic
1034172069 7:149070479-149070501 CTGTCCTGCTCCAAATGAACTGG - Exonic
1037228548 8:16625558-16625580 TTAACATGCTTCAAAAATACAGG - Intergenic
1037582471 8:20253735-20253757 TTCAGCTGCTTCAAAGCAACAGG - Intronic
1038235997 8:25755776-25755798 GTGACTTGCTTCTAAAGAACAGG - Intergenic
1043563526 8:81522530-81522552 TTTCCCAGCTTAAAAAGAACAGG + Intergenic
1045022491 8:98056000-98056022 TTGAACTGCTTGAAAATAAATGG - Intergenic
1048754036 8:137714994-137715016 TTGTCCTGCTTAAAAAGTAAAGG - Intergenic
1050330513 9:4540772-4540794 ATTTCCTGCTTCAAAAGCACAGG + Intronic
1050975439 9:11931738-11931760 TTTACCTGCCTTAAAAGAGCAGG + Intergenic
1056444979 9:86656780-86656802 GTGACCTGCTTCAAAATCCCCGG + Intergenic
1056920361 9:90782480-90782502 GTGTCCTGTTTCAAAAGAAAGGG + Intergenic
1057865794 9:98679716-98679738 CTGACTTGCTTCAAGAGAAAAGG - Intronic
1058944798 9:109846289-109846311 GGGACCTGCTTCAAGAGAAAGGG + Intronic
1059458659 9:114415678-114415700 TTGATCAGCTTCAAGAGCACAGG + Intronic
1059960099 9:119556392-119556414 TTGACCTGCTTCCAAAAAGCCGG + Intergenic
1059975430 9:119711383-119711405 CTGATTTACTTCAAAAGAACAGG - Intergenic
1062379622 9:136280956-136280978 TTGATTTTCTTCAAAAGAACAGG - Intergenic
1186072536 X:5838133-5838155 GTGACCTGCTTCTAAAAAATTGG + Intergenic
1186926675 X:14340802-14340824 TTGAGCTGCATCAGAATAACTGG - Intergenic
1187187960 X:17005479-17005501 TAGACTTGCTTCAAAATAAAAGG - Intronic
1188310596 X:28612284-28612306 TTGACCTTCTTTCAAAGAAAGGG + Intronic
1189559756 X:42179858-42179880 TTGTCCAGATTCAAAAGAAAGGG - Intergenic
1189632039 X:42964975-42964997 TTGGCCTGTGTCAAAATAACAGG - Intergenic
1195376399 X:104231968-104231990 TGGATTTGCTTCAAAATAACAGG - Intergenic
1195901855 X:109806913-109806935 TTGACATGTTTGAAAAGTACAGG - Intergenic
1198729033 X:139707521-139707543 TTTGCGTGCTTAAAAAGAACTGG + Intronic
1199880086 X:151967208-151967230 TTGACATGCTAGAAAAGAAGGGG + Intronic