ID: 1076895734

View in Genome Browser
Species Human (GRCh38)
Location 10:133310469-133310491
Sequence CTGCCGAAGGGAGGCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076895720_1076895734 18 Left 1076895720 10:133310428-133310450 CCCTGGCAACACAGCTACAGGTG 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1076895734 10:133310469-133310491 CTGCCGAAGGGAGGCTGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 351
1076895718_1076895734 25 Left 1076895718 10:133310421-133310443 CCTGAAGCCCTGGCAACACAGCT 0: 1
1: 0
2: 1
3: 42
4: 375
Right 1076895734 10:133310469-133310491 CTGCCGAAGGGAGGCTGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 351
1076895721_1076895734 17 Left 1076895721 10:133310429-133310451 CCTGGCAACACAGCTACAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1076895734 10:133310469-133310491 CTGCCGAAGGGAGGCTGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076895734 Original CRISPR CTGCCGAAGGGAGGCTGGAG GGG Intronic
900520436 1:3102774-3102796 CTGCGGAAGGGACTCTGGAAGGG + Intronic
900550229 1:3250882-3250904 CTGCAGAAGTGGGGCTGGAGTGG + Intronic
902311779 1:15586647-15586669 CTCCAGAGTGGAGGCTGGAGTGG - Intronic
902361536 1:15944874-15944896 CAGCCGGTGGGAGGCCGGAGGGG + Intronic
903029352 1:20451877-20451899 CTGCTGAGGGGTTGCTGGAGGGG - Intergenic
904263842 1:29306614-29306636 CTGCCTCTGGGTGGCTGGAGAGG + Intronic
904354629 1:29930993-29931015 CAGCCAGAGGGTGGCTGGAGTGG + Intergenic
905546930 1:38807531-38807553 CTGGAGATGGGAGGTTGGAGGGG - Intergenic
905916398 1:41687474-41687496 CTGCCACATGCAGGCTGGAGAGG + Intronic
906265392 1:44424911-44424933 CTGCCGAGAAGGGGCTGGAGAGG + Intronic
906279327 1:44542818-44542840 CTGACCAAAGAAGGCTGGAGAGG + Intronic
906476371 1:46172032-46172054 CTGCCTGAGGCTGGCTGGAGCGG + Intronic
906685389 1:47760060-47760082 CTGCCGAAGGAAGAGTGGACTGG + Intergenic
906805846 1:48777897-48777919 TTGCCAAAGAGAGCCTGGAGGGG + Intronic
907222270 1:52915588-52915610 CTGGAGAAGGGAGACTGCAGTGG + Intronic
907431373 1:54414078-54414100 CTGGGGAAGGGAGGGTGAAGGGG - Intergenic
907436427 1:54452186-54452208 CTGTGGAGGGGAGGCTGGAGAGG - Intergenic
907448362 1:54524870-54524892 CTGACGCAGTGAAGCTGGAGTGG + Intergenic
907510524 1:54954624-54954646 CTGCAGGGAGGAGGCTGGAGAGG + Intergenic
912716942 1:111989787-111989809 CTGCCGAGCCGGGGCTGGAGCGG - Intergenic
912972752 1:114299522-114299544 CTGCCGCAAGAGGGCTGGAGAGG - Intergenic
913685394 1:121227026-121227048 CTGCAGCAGGGAGGCTGGTCAGG + Intronic
914018049 1:143839337-143839359 CTTCCGGGAGGAGGCTGGAGCGG - Intergenic
914037241 1:144014630-144014652 CTGCAGCAGGGAGGCTGGTCAGG + Intergenic
914152214 1:145053302-145053324 CTGCAGCAGGGAGGCTGGTCAGG - Intronic
914656662 1:149747870-149747892 CTTCCGGGAGGAGGCTGGAGCGG - Intergenic
915121126 1:153630037-153630059 CAGCAGAAGGAAGGCTGTAGTGG + Intronic
915340630 1:155174862-155174884 ATGGGGAATGGAGGCTGGAGTGG + Intronic
917285831 1:173420479-173420501 GTGCCTAAGTGAGGCTGGAAAGG - Intergenic
918468200 1:184843188-184843210 CTTCCGAAGGGAGGAGGAAGGGG - Intronic
920079575 1:203362474-203362496 CTCCTGAAGAGAGGCAGGAGTGG + Intergenic
920203135 1:204272978-204273000 GAGCAGAAGGCAGGCTGGAGAGG - Intronic
920350958 1:205337658-205337680 GTGCCGAAGGGAGGGAGGTGGGG - Intronic
920472712 1:206245584-206245606 CTGCAGCAGGGAGGCTGGTCAGG + Intronic
922767917 1:228165718-228165740 CCGCCGGAGGGAGGCGGGAAGGG - Intergenic
923029251 1:230234261-230234283 CTTCTGAAGGGAAGTTGGAGGGG + Intronic
923140887 1:231161274-231161296 CTGCCGAGGGAAGGCTGGGTGGG - Intergenic
923274056 1:232381359-232381381 GTGCCGAAGGGTGGGTGGGGTGG - Intergenic
924434147 1:244023647-244023669 CTCAAGAAGGGAGGCTGGGGTGG + Intergenic
1062948129 10:1476221-1476243 CTGCAGGAAGGAGCCTGGAGTGG + Intronic
1063505372 10:6593474-6593496 GTGCCGAGGGCAGGCTGCAGTGG - Intergenic
1064348451 10:14554486-14554508 CAACAGAAGGGAGGCAGGAGAGG + Intronic
1065140184 10:22713393-22713415 CTGCGGAAGGGCGGCCGGGGCGG - Intronic
1069744460 10:70706331-70706353 CTGTCACAGGAAGGCTGGAGAGG - Intronic
1069772964 10:70911070-70911092 CTCCTGAAGGGAGGCCTGAGAGG - Intergenic
1070797934 10:79227949-79227971 CTGGCAGAGGGAGGCTGGACAGG + Intronic
1071622543 10:87134867-87134889 CTCCAGAAGGCTGGCTGGAGAGG + Intronic
1073224087 10:101901707-101901729 CTACAGAAGGGAGGCTTGAGAGG + Intronic
1076125191 10:127968519-127968541 CTGCAGAATGGAGGCTGGGGAGG - Intronic
1076128121 10:127992151-127992173 GTGAGAAAGGGAGGCTGGAGGGG + Intronic
1076167842 10:128296732-128296754 GTGCCGAGAGGAGGCTGGACAGG + Intergenic
1076220374 10:128729016-128729038 GCGCCGACGGGAGCCTGGAGAGG + Intergenic
1076272515 10:129166469-129166491 CGGCCCAAGGGAGGGTGGAGGGG + Intergenic
1076290420 10:129341349-129341371 CTCTGGAAGGGAGGCTGGGGAGG + Intergenic
1076574568 10:131455346-131455368 CAGCTGTAGGGAGGTTGGAGAGG + Intergenic
1076895734 10:133310469-133310491 CTGCCGAAGGGAGGCTGGAGGGG + Intronic
1077210132 11:1367046-1367068 CCACGGAGGGGAGGCTGGAGCGG + Intergenic
1077349319 11:2084963-2084985 CTGAGGAGGGGAGGCTGGAGAGG + Intergenic
1077906201 11:6535744-6535766 ATGTGGAAGGAAGGCTGGAGTGG + Intronic
1078633519 11:13028136-13028158 GTGGGGAGGGGAGGCTGGAGAGG + Intergenic
1080002308 11:27363361-27363383 CTGGCTAAGGGAGGCCGGGGCGG - Exonic
1080683277 11:34495580-34495602 CCACCGAAGGGTGGGTGGAGGGG + Intronic
1083488193 11:62996520-62996542 CAGCCCAAGGAAGGCTGGGGAGG - Intronic
1083620206 11:64045484-64045506 CTGCCGTGGGGCAGCTGGAGAGG + Intronic
1084512748 11:69616348-69616370 CTGCTGAGGGCTGGCTGGAGAGG + Intergenic
1084951999 11:72671547-72671569 CTGGGGACAGGAGGCTGGAGTGG + Intronic
1085192676 11:74641830-74641852 CTCCCTAAGAGAGGATGGAGAGG + Exonic
1085410008 11:76285290-76285312 CGGCCGAGGTGAGGCTCGAGGGG + Intergenic
1086049906 11:82577558-82577580 CTGGGGAAGCGGGGCTGGAGGGG + Intergenic
1088242343 11:107785340-107785362 CTGGGGAAGGGGGGCTGGCGAGG + Intergenic
1088504173 11:110512992-110513014 CAGCCAAGGGGAGGCTGCAGAGG - Intergenic
1089405830 11:118196639-118196661 TTGCCCAAGGGAGGCTGCTGAGG - Intronic
1089844255 11:121446084-121446106 CTGCCGAAGGGTGTGAGGAGCGG + Intergenic
1089955697 11:122569127-122569149 ATGCCGTGGGGAGGCAGGAGGGG + Intergenic
1090246074 11:125216750-125216772 CTGCTGAAGGGACAGTGGAGGGG - Intronic
1090381138 11:126328497-126328519 CTGCTGAGGGGAGGCGGGAGGGG + Intronic
1090474011 11:127003718-127003740 CTGGCGAAGAAACGCTGGAGAGG - Intergenic
1091391484 12:128899-128921 CTGTGGCAGGGAGCCTGGAGAGG - Intronic
1091841466 12:3624289-3624311 CTGGAGAAGGGAGGGTGGAGGGG - Intronic
1092435507 12:8443728-8443750 CTGCCGAGGGAGGGGTGGAGTGG + Intergenic
1093443235 12:19224886-19224908 CAGCTGACAGGAGGCTGGAGTGG + Intronic
1093925308 12:24903154-24903176 CTCCCCAAGGGATGCTGGAGGGG - Intronic
1094843023 12:34349853-34349875 CAGCCGCAGGGAGGCTTGAACGG - Intergenic
1097120163 12:56725327-56725349 TTGCAGAAGGAAGCCTGGAGCGG + Intronic
1099693902 12:85994066-85994088 CTGCAGCAGGGAGGCTGGCCTGG - Intronic
1100394392 12:94171903-94171925 CTGCCCTAGGGAGCCTGGTGGGG - Intronic
1100745024 12:97636162-97636184 CTGGCGATGGGAGGCAAGAGGGG - Intergenic
1100912507 12:99381492-99381514 CTCACAAAGGGAGACTGGAGAGG + Intronic
1101238839 12:102817898-102817920 CTGACAGAGGGAGGCAGGAGGGG - Intergenic
1102352891 12:112207638-112207660 CTGCTGCAGTGAAGCTGGAGTGG - Intronic
1103004959 12:117413797-117413819 CTGGACTAGGGAGGCTGGAGGGG - Intronic
1103348075 12:120264690-120264712 CTGACGCAGAGAGGGTGGAGGGG + Intronic
1103477915 12:121232286-121232308 CGGCTGAATGGACGCTGGAGCGG - Intronic
1103764505 12:123271190-123271212 CTGCCGGCGGGAGTCGGGAGCGG - Intronic
1104729696 12:131098039-131098061 CTGCCCAGGTGAGGCTGGCGCGG - Intronic
1104755789 12:131268693-131268715 CTGCAGTTGGGAGGCTGGTGGGG - Intergenic
1104775629 12:131388616-131388638 CTGCAGCAGGGAGGCAGGGGAGG - Intergenic
1104777917 12:131401988-131402010 CTGCAGTTGGGAGGCTGGTGCGG + Intergenic
1104834507 12:131779328-131779350 CTCCTGGAGGGAGGGTGGAGAGG - Intronic
1107508900 13:41061751-41061773 CGGCCGAAGGGCGGGAGGAGAGG - Intronic
1107544678 13:41424627-41424649 CTGCCGAGGGAGGGGTGGAGTGG + Intergenic
1112208286 13:97347239-97347261 GTGCTGAAGGGGGGCAGGAGGGG - Intronic
1113458527 13:110465766-110465788 CTGCTGAGGGGAGGCTGGTGGGG - Intronic
1113489164 13:110677955-110677977 CTGCCCACTGGCGGCTGGAGGGG - Intronic
1113822790 13:113227053-113227075 AGGATGAAGGGAGGCTGGAGAGG + Intronic
1113899259 13:113787612-113787634 GTGAAGAAGGGAAGCTGGAGAGG + Intronic
1113962197 13:114132357-114132379 CTGCGGAGGGGAGGCGGGCGCGG + Intronic
1117297791 14:54394824-54394846 CTCCCGAAGCGTGGCTAGAGTGG + Intergenic
1118586696 14:67359975-67359997 CAGCCGCAGGGAAGCTGGATGGG - Exonic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1119164190 14:72478825-72478847 CTGTGGAAGCCAGGCTGGAGGGG - Intronic
1122410872 14:101525608-101525630 CTGGCGAGGTGTGGCTGGAGTGG - Intergenic
1124139739 15:27067091-27067113 CAGCCGCAGGGAGGCTGGGCAGG - Intronic
1125314554 15:38417261-38417283 CTGCCAAAGTGGGACTGGAGCGG + Intergenic
1125723227 15:41855117-41855139 CAGCAGAAAGGAGCCTGGAGAGG - Intronic
1127068265 15:55262743-55262765 CTGGACAAGGGAGGCTGGGGCGG - Intronic
1128376658 15:67081365-67081387 CTGGGGAAGGGAGGCTGGCAAGG - Intronic
1128725363 15:69983966-69983988 CTGCCCAAGGTAGGCTGCTGAGG + Intergenic
1129033896 15:72638435-72638457 CTGCAGCAGGGAAGCTGGAGTGG + Intergenic
1129215986 15:74098781-74098803 CTGCAGCAGGGAAGCTGGAGTGG - Intergenic
1129264961 15:74388509-74388531 CTGCCGAAGGAGGGCTGGGCAGG + Intergenic
1129408806 15:75337671-75337693 CAGCAGCAGGGAAGCTGGAGTGG + Intronic
1129669180 15:77597738-77597760 CTCAGGGAGGGAGGCTGGAGGGG - Intergenic
1130076443 15:80694831-80694853 CTGCAGAGGGGACCCTGGAGGGG - Intronic
1130541309 15:84822495-84822517 CAGCCGAAGGGAGTGTGGATGGG + Intronic
1131234046 15:90681214-90681236 GGGCAGCAGGGAGGCTGGAGAGG + Intergenic
1131518121 15:93092923-93092945 GTGCCAACGGGAGGCTGAAGAGG + Intergenic
1132070946 15:98776110-98776132 CTCCCGAAGGGAGGGTGGAAGGG + Intronic
1132381410 15:101369146-101369168 CTGCAGCAGGCAAGCTGGAGCGG - Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132880557 16:2160055-2160077 TTGCCGAAGAGGGGCTGGGGTGG + Intronic
1133647682 16:7779457-7779479 CTTCCCAAGAGAGGCTGGAGAGG - Intergenic
1135128344 16:19830394-19830416 CTGCAGCAGAGGGGCTGGAGGGG + Intronic
1136293613 16:29289994-29290016 CTGCCACAGGGAGGCTGGTGTGG - Intergenic
1137445096 16:48526814-48526836 CTGTCGAAGGTAGGTGGGAGAGG - Intergenic
1137756482 16:50906369-50906391 CTGTCACAGGGAGGCTGGGGAGG + Intergenic
1138089031 16:54159165-54159187 CTGCCGTAGGGAGGCCCTAGTGG - Intergenic
1138532494 16:57642257-57642279 CGGCCGAAGGGAGGTGGGATAGG + Intronic
1138655454 16:58488647-58488669 CTGGTGATGGGAGGCTGGGGAGG - Intronic
1139291493 16:65862588-65862610 CAGCCCAAGGGAGGGTGGGGTGG + Intergenic
1139957891 16:70701782-70701804 CAGCAAGAGGGAGGCTGGAGAGG - Intronic
1140406239 16:74713483-74713505 CTCCCCAAGGGAGGCTGAGGAGG - Exonic
1140419665 16:74807827-74807849 CTGCAGGAGGGAGGCTGGCTGGG - Intergenic
1140759013 16:78094634-78094656 CTGTCAGAGGGAGGCAGGAGGGG - Intergenic
1141193628 16:81842889-81842911 CTGAGGGAGGGTGGCTGGAGTGG + Intronic
1141593276 16:85082558-85082580 CTCCAGAGGGGATGCTGGAGAGG + Exonic
1141695506 16:85617250-85617272 CTGCCCCCGGGAGGCTGGGGCGG + Intronic
1141715632 16:85725201-85725223 GAGCCGAAGGGAGGCTGGAGTGG + Intronic
1141891529 16:86929670-86929692 CCGACGAAGGGAGGAGGGAGTGG - Intergenic
1142099495 16:88264000-88264022 CTGCCACAGGGAGGCTGGTGTGG - Intergenic
1142186583 16:88697721-88697743 CTGCTGGAGGGAGGCAGGAAGGG - Intronic
1142197113 16:88744079-88744101 CTGCTGAAGAGGGGCTGGCGCGG - Intronic
1142232035 16:88904575-88904597 AGGCCGAACGGAGGCTGCAGGGG + Intronic
1142781829 17:2187099-2187121 GTGCTGAAGGAAGGCTGGAAGGG - Intronic
1143140897 17:4741176-4741198 CTTCCGAAGGGAGGATGGCTGGG - Intronic
1143350997 17:6288268-6288290 CTGCCGGGGGGCGGGTGGAGAGG - Intergenic
1143868227 17:9939478-9939500 TAGACAAAGGGAGGCTGGAGTGG + Intronic
1144339463 17:14300318-14300340 CTGCCGAAAGTAGGTTGGGGAGG - Intergenic
1144629692 17:16864719-16864741 CTGCCCAAGGGAGCCAGGAGAGG + Intergenic
1144651736 17:17011398-17011420 CTGCCCAAGGGAGCCAGGAGAGG - Intergenic
1148012328 17:44493166-44493188 CTGCGGAGGGGAGGCTGCTGAGG - Intronic
1148105176 17:45115025-45115047 CTCCTGAAGGGAGTCTGGAAAGG - Intronic
1148674654 17:49438426-49438448 CTGCTGGAGGGACGCTGCAGGGG + Intronic
1148695779 17:49557227-49557249 CCGGCGAAGGGGGACTGGAGAGG - Intergenic
1151536754 17:74743279-74743301 CAGCAGAAGCAAGGCTGGAGGGG - Exonic
1152155279 17:78628960-78628982 ATGCAGAACGGAGGCTGCAGGGG + Intergenic
1152253509 17:79224185-79224207 CTGCGGTGGGGAGGCTGCAGAGG - Intronic
1152603016 17:81274585-81274607 CTCCCAAGGGGAGGCAGGAGGGG + Intronic
1153229304 18:2921165-2921187 CTGCAGAAGGGAGGCAGGTTGGG + Intronic
1153319682 18:3760268-3760290 CTGCGGAAGGAAGACAGGAGGGG + Intronic
1154198720 18:12284807-12284829 CTGCGGTAGGGAAGCTGGACAGG - Intergenic
1154201323 18:12302555-12302577 CTGCTGCAGGGAGGCTGGTGGGG - Intergenic
1154214118 18:12402943-12402965 CTGCAGAGGGGAAGCTGCAGAGG + Intergenic
1156747884 18:40414779-40414801 GGGCAGAAGGGAGACTGGAGAGG + Intergenic
1157391559 18:47307530-47307552 CAGCCGAAGTGATCCTGGAGGGG + Intergenic
1157526117 18:48383859-48383881 GTGCCTAAGTGAGGCTGGAAGGG + Intronic
1158466921 18:57698773-57698795 ATGCCCTAGGGAGGCTGAAGGGG - Intronic
1159734332 18:72075327-72075349 CTGCCAAAAGGAAGCTGGGGTGG + Intergenic
1160830714 19:1103874-1103896 CAGCCAATGGGAGGCCGGAGTGG - Intergenic
1160865848 19:1255638-1255660 CTGCAGCAGGGAGGCTGAGGGGG - Exonic
1160967004 19:1751041-1751063 CAGCCGAAGGGAGGGGTGAGGGG + Intergenic
1161382073 19:3970829-3970851 CGGCCCCAGGGATGCTGGAGCGG - Intronic
1161508765 19:4658713-4658735 ATGCCGAGGGGAGGCTGCAGGGG - Intronic
1162722001 19:12668163-12668185 CAGGGGAAGGGAGGCAGGAGGGG + Exonic
1163265350 19:16217460-16217482 CTGCACAGGGGAGGCTGCAGTGG + Intronic
1163426692 19:17244408-17244430 CAGACGGAGGGAGGCTGGGGTGG - Intronic
1164400748 19:27900574-27900596 ATTCCCAAGGGAGGCAGGAGAGG + Intergenic
1164916056 19:32053144-32053166 CTTCCCAAGGGAGGCTGTGGGGG + Intergenic
1166190953 19:41176211-41176233 CTGCAGAGGGGAGGGTGGAGGGG + Intergenic
1167576549 19:50320522-50320544 CTGCCCAGGGGAGGGAGGAGAGG - Intronic
1167600406 19:50451462-50451484 CTGAGGAAGGGAGGGAGGAGGGG + Intronic
925195890 2:1925455-1925477 CTGCTGAAGGGAGAATGTAGGGG - Intronic
926528520 2:14012134-14012156 CAGCCGAAGGGGAGCTGGAAAGG - Intergenic
926686745 2:15704095-15704117 CTTCCCCAGGGAGGCTGGGGAGG + Intronic
928180124 2:29062860-29062882 CAGCTGCAGGGAGACTGGAGTGG - Exonic
928983465 2:37158230-37158252 ATGGAGAAGGGAGGCTGGAGAGG - Intergenic
929487353 2:42366840-42366862 CTGGGGAAGGGAGGCTGAAGAGG - Intronic
929787250 2:45001686-45001708 CTGCCTAGGAAAGGCTGGAGGGG - Intergenic
932571348 2:72940087-72940109 CTGCAGAGTGGAGGGTGGAGTGG - Intergenic
933671484 2:85011702-85011724 CTGCCAATGGGAGGCTTCAGAGG - Intronic
934513196 2:94964696-94964718 CTGCAGGACAGAGGCTGGAGTGG - Intergenic
935740560 2:106143839-106143861 AGGCAGAAGGGAAGCTGGAGAGG - Intronic
935782121 2:106517578-106517600 CTGGGGAAGGGAGGCTGACGGGG - Intergenic
936608383 2:113979257-113979279 AAGCAGAAGGGAGGCAGGAGCGG + Intergenic
937265442 2:120612215-120612237 CTGCGAAAGGGATCCTGGAGAGG - Intergenic
937274088 2:120673137-120673159 CTGCAGAAGGGAGGCTGCTCAGG + Intergenic
937904397 2:127045871-127045893 CTGGCTCCGGGAGGCTGGAGGGG + Intergenic
939096912 2:137842694-137842716 CTGCCAGAGGAAGGCTGGAAAGG + Intergenic
939748709 2:146012808-146012830 CTGCCGAGAGAAAGCTGGAGAGG + Intergenic
941915918 2:170813881-170813903 ATGCCGGAGAGAGACTGGAGGGG + Intronic
942261837 2:174172604-174172626 CTGCCAAAGGTAGTCTAGAGAGG + Intronic
944826608 2:203489670-203489692 CTGCGGAAGTGATGCTGGAATGG + Exonic
946202195 2:218076815-218076837 CTGCCCAGGGGAGGCAGCAGAGG - Intronic
946766356 2:223044587-223044609 CTGCCCAAGGCAGCCAGGAGCGG - Intergenic
947392417 2:229652888-229652910 CTGCAAAAGGGAGCATGGAGAGG + Intronic
947860861 2:233356099-233356121 CTGCCCTGGGGAGGCAGGAGTGG + Intronic
948632837 2:239312985-239313007 CTGCCGACGGGAGGCAGACGAGG + Intronic
948732820 2:239977955-239977977 CTGCTGAGGGGAGGCTGGAGGGG - Intronic
949032776 2:241804854-241804876 CTTGCCAAAGGAGGCTGGAGTGG + Intergenic
949069602 2:242016096-242016118 ATGCAGGAGGGAGGCAGGAGGGG + Intergenic
1168913733 20:1469585-1469607 GTGCCAAAGGAAGGCTGGGGTGG - Intronic
1169316173 20:4592665-4592687 CTCCCCAAGGCAGCCTGGAGTGG + Intergenic
1169646168 20:7812449-7812471 CAGGCAAAGGGAGTCTGGAGTGG - Intergenic
1171248484 20:23632070-23632092 CTGCGGAGGGGAGGCAGGGGTGG + Intronic
1171769693 20:29313103-29313125 CTGCCGGGTGGAGGGTGGAGTGG + Intergenic
1172340827 20:34156041-34156063 CTGCCGAAGGGAAGTGAGAGGGG + Intergenic
1172635191 20:36405599-36405621 ATGGGGCAGGGAGGCTGGAGCGG + Intronic
1174200841 20:48805454-48805476 CCGCAGAAGGTAGGGTGGAGGGG - Intronic
1174303063 20:49596018-49596040 CCGCCAAAGGGAGGCAGGAAAGG + Intergenic
1175138511 20:56842626-56842648 GCGCAGAAGGGAGGCTGGTGTGG + Intergenic
1175267140 20:57709780-57709802 CTGCCGAGGGGAGGCCGGGGGGG - Exonic
1176047347 20:63099758-63099780 CAGCCAAAGGGAGGAGGGAGTGG + Intergenic
1176262232 20:64187936-64187958 CTGCCTCAGGGAGGCAGGAGTGG + Intronic
1179788747 21:43743612-43743634 CTGCAGAGGGGTGGCTGGGGAGG - Intronic
1180185200 21:46135847-46135869 CTGGGGAGGGGAGGCTGGGGAGG - Intergenic
1180595493 22:16970242-16970264 CTGCCCCAGGGAGGCAGGCGGGG + Intronic
1181344012 22:22203837-22203859 CTACTAGAGGGAGGCTGGAGAGG + Intergenic
1181543771 22:23588878-23588900 CTGACAAAGGTGGGCTGGAGTGG - Intergenic
1182048904 22:27298525-27298547 CTGCAGAAGGGTGGGTGGTGCGG + Intergenic
1182666677 22:31965205-31965227 CAGCGGAAAGCAGGCTGGAGAGG - Intergenic
1182684054 22:32107155-32107177 CTGCCCCAGGGAGGCAGGAAGGG - Intronic
1183003835 22:34883791-34883813 CTCCCCAAGGGACCCTGGAGGGG - Intergenic
1183498880 22:38166256-38166278 CAGCCAAAGGGAGGGTGGAAGGG - Intronic
1183686435 22:39363706-39363728 CTGCCTGGAGGAGGCTGGAGAGG + Intronic
1184033772 22:41909249-41909271 CTGCAGAGTGGCGGCTGGAGGGG + Intergenic
1184172584 22:42768720-42768742 ATGCCTGAGGGTGGCTGGAGGGG - Intergenic
1184245357 22:43232995-43233017 CTGCTGGAGAGAGTCTGGAGGGG - Intronic
1184290929 22:43497794-43497816 CTGGGGGAGGGAGGATGGAGGGG + Intronic
1184729091 22:46363403-46363425 CTGCCCTTGGGAGGCAGGAGAGG + Intronic
950494325 3:13324553-13324575 ATCCAGAAGTGAGGCTGGAGGGG - Intronic
951637783 3:24798644-24798666 ATGCAGAAGGGGGGATGGAGTGG - Intergenic
952138723 3:30454772-30454794 GTGCTGAAGGGACCCTGGAGAGG + Intergenic
952269556 3:31817806-31817828 CTGCAGCAGGGAGGCTTGACTGG - Intronic
953207871 3:40847986-40848008 CTGCAGCAGGGAGTCTGGAGGGG + Intergenic
953244280 3:41176593-41176615 CAGCCCAAAGGAGGCTGGACAGG + Intergenic
953801810 3:46030681-46030703 CTGCAGCAGGGAGGCATGAGCGG + Intergenic
954151237 3:48658250-48658272 CTGCCTACTGGAGGCTGCAGAGG - Intronic
954647445 3:52140291-52140313 CTCCAGGAGGCAGGCTGGAGAGG + Intronic
954701009 3:52450956-52450978 CTGCAGAAGGCAGTGTGGAGCGG + Intergenic
954709856 3:52500163-52500185 GGCCCGAGGGGAGGCTGGAGAGG - Intronic
955755204 3:62218884-62218906 CTGCTCCAGGGAGGATGGAGTGG + Exonic
958531347 3:95335440-95335462 CTCCCAGAGGGAGGCTGAAGCGG - Intergenic
958903982 3:99921977-99921999 CTTCTGGAGGAAGGCTGGAGAGG - Intronic
958963236 3:100530429-100530451 CTGGTGAATGGAGGCTGGAGGGG - Intronic
961044230 3:123697908-123697930 CATGGGAAGGGAGGCTGGAGTGG + Intronic
961497846 3:127307084-127307106 CTGTGGGAGGGAGACTGGAGGGG - Intergenic
961554797 3:127690461-127690483 CTGCTGGAGGGAGGGTGGAGGGG + Exonic
961812455 3:129529679-129529701 ACGCGGCAGGGAGGCTGGAGGGG - Intronic
962425974 3:135269803-135269825 CTGCCTAAGGTGGACTGGAGGGG + Intergenic
963103060 3:141623810-141623832 CTGCTGGAGGGAGGAAGGAGGGG - Intergenic
966926917 3:184650555-184650577 CTGCAGGAGGGAGCCTTGAGAGG + Intronic
967009968 3:185423534-185423556 CAGGGGAGGGGAGGCTGGAGTGG + Intronic
968440809 4:623626-623648 CTGCCCAAGGGAGCGTGGAGTGG - Intergenic
968534231 4:1113325-1113347 TTCCCGAACGCAGGCTGGAGAGG - Intronic
968613614 4:1567792-1567814 GTGTGGAGGGGAGGCTGGAGGGG - Intergenic
969315131 4:6377330-6377352 CTGCCCAAGGGAGGCAGGGCAGG + Intronic
969537580 4:7766237-7766259 CTGTCCCAGGGAGGCTGAAGGGG - Intronic
969590508 4:8119265-8119287 AAGCCCAAAGGAGGCTGGAGAGG + Intronic
969647468 4:8440890-8440912 CGGTCGAAGTGTGGCTGGAGAGG + Exonic
971501099 4:27318638-27318660 CTGCAGAAGTGAGGCTGGAGAGG + Intergenic
971949964 4:33332284-33332306 TTGCAGAACCGAGGCTGGAGGGG + Intergenic
973823865 4:54685678-54685700 CTGCCGGTGTGAGGCTAGAGAGG - Intronic
975303205 4:72816362-72816384 CTGCCCTGGGAAGGCTGGAGAGG + Intergenic
975492726 4:75006289-75006311 CTGCCGTAGGGTGGGGGGAGGGG - Intronic
975529513 4:75386072-75386094 GGGCCCCAGGGAGGCTGGAGAGG - Intergenic
976436405 4:85023488-85023510 TTGCCGAAGGCAGGCTGGGCGGG + Intergenic
977695831 4:99964491-99964513 CCGCCTTAGGGAGGCTGTAGAGG + Intergenic
981007295 4:139889056-139889078 CTGAGGGAGGGAGGCTGCAGAGG - Intronic
981728440 4:147872198-147872220 CTGCGGCAGGGATGGTGGAGTGG + Intronic
981938258 4:150256307-150256329 CTGCAGCAGGGAGGCCGGCGAGG - Exonic
982232595 4:153222837-153222859 CTGCAGAAGGGCGGCTGCGGGGG + Intronic
982717875 4:158827828-158827850 CTTGCCAAGGGAGGCTGGGGCGG - Intronic
983376812 4:166940327-166940349 CTTCGGTAGGGAGGCTGTAGTGG - Intronic
984708259 4:182863581-182863603 CTGCAGCCTGGAGGCTGGAGGGG - Intergenic
985030164 4:185781524-185781546 CAATGGAAGGGAGGCTGGAGAGG - Intronic
985030172 4:185781554-185781576 CAATGGAAGGGAGGCTGGAGAGG - Intronic
985030180 4:185781584-185781606 CAAGGGAAGGGAGGCTGGAGGGG - Intronic
985030192 4:185781614-185781636 CAATGGAAGGGAGGCTGGAGGGG - Intronic
985030211 4:185781674-185781696 CAATGGAAGGGAGGCTGGAGAGG - Intronic
985723973 5:1506090-1506112 CTGATGAGGGGAGGGTGGAGAGG + Intronic
986337395 5:6765916-6765938 CTGCAGCAGGGAGGCTGGCAGGG - Intergenic
986681002 5:10232749-10232771 TGGCCCAGGGGAGGCTGGAGGGG + Intronic
991920660 5:71653522-71653544 CTGGCGAAGGCAAACTGGAGAGG + Intronic
996245890 5:121263434-121263456 ATGCAGAAGGGAGGTTGGAGGGG + Intergenic
997881959 5:137599671-137599693 GTGCCGGAGGAAGGCTGGGGTGG + Intergenic
997887523 5:137643879-137643901 CTGGGGAAGGGAGGAGGGAGGGG - Intronic
998469761 5:142374593-142374615 GGGCAGAAGGGAGACTGGAGTGG + Intergenic
1000981935 5:167825462-167825484 GAGCAGAAGGGAGGCTGGGGAGG + Intronic
1001482288 5:172096547-172096569 CTGACGAAGGGATGCTGAGGGGG + Exonic
1001953701 5:175833701-175833723 GTGGGGATGGGAGGCTGGAGAGG + Intronic
1001963089 5:175892398-175892420 CTGTTGTAGGGAGGCAGGAGAGG - Intergenic
1003535198 6:6970208-6970230 TTGGAGGAGGGAGGCTGGAGGGG + Intergenic
1003984040 6:11417466-11417488 CTCCTCAAGGGCGGCTGGAGTGG + Intergenic
1006107190 6:31723803-31723825 CGGCCGACGAAAGGCTGGAGGGG - Exonic
1006796493 6:36735594-36735616 CAGCTGAGGGGAGACTGGAGAGG - Intergenic
1007281168 6:40713535-40713557 CTACCAAAGGGCTGCTGGAGGGG + Intergenic
1007320895 6:41028211-41028233 CTGCTGCTGGGAGGCTGGCGAGG + Exonic
1007418055 6:41703484-41703506 CAGCCACAGGGAGGCTGGGGAGG - Intronic
1008563062 6:52740657-52740679 CTGCCCAAGAGAGATTGGAGAGG - Intergenic
1008564311 6:52752083-52752105 CTGCCCAAGGGAGATTGGAGCGG - Intronic
1008568620 6:52793363-52793385 CTGCCCAAGGGAGATTGGAGAGG - Intronic
1008573074 6:52833365-52833387 CTGCCCAAGGGAGATTGGAGAGG - Intronic
1008580038 6:52898328-52898350 CTGCCCAAGGGAGATTGGAGAGG - Intronic
1010522251 6:76852053-76852075 CTGGAGAGGGGAGGCTGAAGGGG + Intergenic
1012244589 6:96912271-96912293 CTGCCATACGGAGGCTGCAGTGG + Intergenic
1013078645 6:106793132-106793154 ATGCAGAATTGAGGCTGGAGTGG + Intergenic
1017002241 6:150004773-150004795 CTGCAGAGGGCAGGGTGGAGCGG - Intergenic
1017728208 6:157290802-157290824 CTGCAGAGGGGAGGCTGGCAGGG - Exonic
1018649128 6:165976812-165976834 CTGCTGCAGGGTGGCTGGTGGGG - Intronic
1019326338 7:440150-440172 CTGCAGAAGGGAAGGTGAAGAGG + Intergenic
1019504920 7:1385967-1385989 ATGCCGCAGGGAGCCAGGAGAGG + Intergenic
1019548795 7:1592097-1592119 CTGCCTGCGGGAGGCTGGACTGG + Intergenic
1019581894 7:1768549-1768571 ATGCCGCAGGGTGGCTGGACCGG - Intergenic
1019644727 7:2122974-2122996 CAGCAGAAGGGAGGCAGGTGAGG - Intronic
1020083577 7:5298968-5298990 CTCCTGGAGGGAGGATGGAGTGG - Exonic
1022135065 7:27439413-27439435 CTGCCACATGGAGGTTGGAGTGG - Intergenic
1023655993 7:42421696-42421718 ATGCTGAAAGGAGGCAGGAGAGG - Intergenic
1023998382 7:45175751-45175773 AGGCCAAAGGAAGGCTGGAGGGG - Intronic
1024973427 7:55091511-55091533 CTGTCGAAGGGAGGTGGGAGGGG - Intronic
1025210706 7:57018225-57018247 CTCCTGGAGGGAGGATGGAGTGG + Intergenic
1025661250 7:63558622-63558644 CTCCTGGAGGGAGGATGGAGTGG - Intergenic
1027108864 7:75421946-75421968 CCGCCAAAGGTAGGCTGGATGGG + Exonic
1029124638 7:98287750-98287772 CTGCAGGTGGGAGGCTGGTGTGG + Intronic
1029161113 7:98552705-98552727 TTTCCAAAGGGAGGCTGGTGCGG + Intergenic
1029893585 7:103957987-103958009 CTGCCAAAGGGAGCCTGAAGGGG - Intronic
1032475958 7:132211617-132211639 CTGCCGCAGGGAGGCTGGGAGGG + Intronic
1032731308 7:134646149-134646171 CAGAGGAAGGGAGGCTAGAGTGG - Intergenic
1032803917 7:135337702-135337724 CTGCCGAAGGGAGGCATGGAAGG - Intergenic
1034263804 7:149772255-149772277 CTGCAGAAGGGAGGGGGGAGGGG - Intronic
1034846567 7:154451607-154451629 CTGCAGAGGGGAGGCTGCTGTGG - Intronic
1035332188 7:158103535-158103557 CTAGGGAAGTGAGGCTGGAGAGG - Intronic
1035473812 7:159128499-159128521 CTGCTGGAGGGAGGGTGAAGGGG - Intronic
1035626019 8:1071146-1071168 CTGCCGAGCGGAAGCTGGGGAGG + Intergenic
1036167343 8:6448380-6448402 CTGCAGGAAGGAGGTTGGAGAGG + Intronic
1037608811 8:20459297-20459319 CTCAGGAAGGGAGGCTGGACAGG - Intergenic
1039742936 8:40398558-40398580 CTCCCTGAGGCAGGCTGGAGAGG + Intergenic
1039766954 8:40639037-40639059 TGGCCGAAGGTTGGCTGGAGGGG - Intronic
1040006669 8:42626973-42626995 CTGCCTAAAGGAGGATTGAGTGG - Intergenic
1040338128 8:46426542-46426564 GTGCCGCAGGGTGGCTGGGGAGG + Intergenic
1041278653 8:56189774-56189796 CTGCACAGGTGAGGCTGGAGAGG + Intronic
1041793526 8:61722582-61722604 CTGTGGAAGGCAGGCTGTAGAGG + Intergenic
1042333920 8:67610682-67610704 CTGAGGAAGGGAGCCTGGATGGG - Intronic
1045826968 8:106409266-106409288 GGGCCAAAGGGAGGATGGAGAGG + Intronic
1048065629 8:130965327-130965349 CTCCAAAAGGGAGGATGGAGGGG + Intronic
1048465096 8:134659017-134659039 ATGCCGAAGGGAGCCAGGTGTGG - Intronic
1049497372 8:142942616-142942638 CTGCAGCAGGGAAGCTGGTGTGG - Intergenic
1049752005 8:144289384-144289406 CTGCTGGTGGGTGGCTGGAGGGG - Intronic
1052998926 9:34566543-34566565 TTTTGGAAGGGAGGCTGGAGGGG - Intronic
1053382199 9:37658210-37658232 ATTCCGAAGTGAGGCTGCAGTGG - Intronic
1053506292 9:38646215-38646237 CTGCAGGGGAGAGGCTGGAGAGG + Intergenic
1054852382 9:69861345-69861367 CTGCAGAAGGGAGATTGAAGAGG - Intronic
1056410083 9:86317091-86317113 CTGGGGAAGGGAGGGTTGAGGGG + Intronic
1056567537 9:87787835-87787857 ATGCTGACGGGAGTCTGGAGAGG - Intergenic
1057236539 9:93366077-93366099 CAGCCATGGGGAGGCTGGAGGGG + Intergenic
1057562261 9:96137962-96137984 CAGCCTCAGGCAGGCTGGAGAGG - Intergenic
1057773136 9:97984390-97984412 CTGCCCCTGGGAGGCAGGAGTGG - Intronic
1058047664 9:100373920-100373942 CTGCCAGTGGGAGGCAGGAGAGG - Intergenic
1060149844 9:121281612-121281634 CTGCCCAGGGAAGCCTGGAGGGG + Intronic
1060407908 9:123381870-123381892 CGGCCCCAGGGAAGCTGGAGGGG + Exonic
1060994354 9:127867721-127867743 CTGGCAAAGGGAGGCTGAGGAGG + Exonic
1061057705 9:128233156-128233178 CTTATGAAGGGAGGCTGAAGGGG - Intronic
1061377797 9:130236380-130236402 GGTCCGGAGGGAGGCTGGAGCGG + Exonic
1061653431 9:132069252-132069274 CGGCCCCAGGGAGGCTGCAGAGG - Intronic
1062019752 9:134313484-134313506 CTGCTGAGAGGAGGCTGGTGAGG - Intergenic
1062303609 9:135889586-135889608 CTGGTGAGGAGAGGCTGGAGGGG + Intronic
1062657583 9:137612284-137612306 CTCCCCCAGGGAGGCCGGAGAGG + Intronic
1062672111 9:137717061-137717083 CTCCCCAAGGGTGGCTGGTGGGG - Exonic
1187768841 X:22672548-22672570 GGGCTGAAGGGAGGTTGGAGAGG + Intergenic
1187795042 X:22994485-22994507 GGGCCGAAGGGAGGTTGGAGAGG - Intergenic
1188576164 X:31652785-31652807 CTGGGGAAGTGAGACTGGAGTGG + Intronic
1190417789 X:50198425-50198447 CTGGGGAGGGGAGGCTGGGGAGG - Intronic
1192240579 X:69324617-69324639 CTGATGTGGGGAGGCTGGAGTGG + Intergenic
1193280671 X:79645382-79645404 CTGGAGAAGGGAGGGTGTAGGGG - Intergenic
1195558844 X:106259852-106259874 CTGACGTAGGGATGCTGCAGAGG - Intergenic
1200268225 X:154658150-154658172 CTGGCCTAGGGAGGGTGGAGAGG - Intergenic