ID: 1076897939

View in Genome Browser
Species Human (GRCh38)
Location 10:133323324-133323346
Sequence GGATTAGGGCATCAGCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076897933_1076897939 2 Left 1076897933 10:133323299-133323321 CCTTTTTTTTACAGCAACACTAA 0: 1
1: 0
2: 1
3: 34
4: 423
Right 1076897939 10:133323324-133323346 GGATTAGGGCATCAGCCACTGGG No data
1076897929_1076897939 30 Left 1076897929 10:133323271-133323293 CCTCCAGAACTGTGAGCCAAATA 0: 71
1: 468
2: 1847
3: 4436
4: 9741
Right 1076897939 10:133323324-133323346 GGATTAGGGCATCAGCCACTGGG No data
1076897930_1076897939 27 Left 1076897930 10:133323274-133323296 CCAGAACTGTGAGCCAAATAAAC 0: 33
1: 149
2: 344
3: 588
4: 901
Right 1076897939 10:133323324-133323346 GGATTAGGGCATCAGCCACTGGG No data
1076897931_1076897939 14 Left 1076897931 10:133323287-133323309 CCAAATAAACCTCCTTTTTTTTA 0: 2
1: 8
2: 53
3: 475
4: 2947
Right 1076897939 10:133323324-133323346 GGATTAGGGCATCAGCCACTGGG No data
1076897932_1076897939 5 Left 1076897932 10:133323296-133323318 CCTCCTTTTTTTTACAGCAACAC 0: 1
1: 0
2: 1
3: 19
4: 311
Right 1076897939 10:133323324-133323346 GGATTAGGGCATCAGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076897939 Original CRISPR GGATTAGGGCATCAGCCACT GGG Intronic
No off target data available for this crispr