ID: 1076902230

View in Genome Browser
Species Human (GRCh38)
Location 10:133345424-133345446
Sequence GTGTCTGAACATGCAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076902222_1076902230 6 Left 1076902222 10:133345395-133345417 CCACCCCCTTGGAAGCACGGCCT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data
1076902224_1076902230 2 Left 1076902224 10:133345399-133345421 CCCCTTGGAAGCACGGCCTCCAA 0: 1
1: 0
2: 1
3: 4
4: 76
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data
1076902219_1076902230 14 Left 1076902219 10:133345387-133345409 CCCTCACTCCACCCCCTTGGAAG 0: 1
1: 0
2: 0
3: 34
4: 276
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data
1076902220_1076902230 13 Left 1076902220 10:133345388-133345410 CCTCACTCCACCCCCTTGGAAGC 0: 1
1: 0
2: 1
3: 40
4: 356
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data
1076902226_1076902230 0 Left 1076902226 10:133345401-133345423 CCTTGGAAGCACGGCCTCCAATT 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data
1076902217_1076902230 27 Left 1076902217 10:133345374-133345396 CCTTTCTTGAGGGCCCTCACTCC 0: 1
1: 0
2: 0
3: 19
4: 222
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data
1076902223_1076902230 3 Left 1076902223 10:133345398-133345420 CCCCCTTGGAAGCACGGCCTCCA 0: 1
1: 0
2: 3
3: 22
4: 184
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data
1076902225_1076902230 1 Left 1076902225 10:133345400-133345422 CCCTTGGAAGCACGGCCTCCAAT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1076902230 10:133345424-133345446 GTGTCTGAACATGCAGCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076902230 Original CRISPR GTGTCTGAACATGCAGCTTC GGG Intronic
No off target data available for this crispr