ID: 1076902676

View in Genome Browser
Species Human (GRCh38)
Location 10:133347656-133347678
Sequence ATCACCCAGGGACCCCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076902668_1076902676 5 Left 1076902668 10:133347628-133347650 CCTCTTGGTTCCCCTGGCCTGGT No data
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data
1076902670_1076902676 -5 Left 1076902670 10:133347638-133347660 CCCCTGGCCTGGTGGAGAATCAC No data
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data
1076902665_1076902676 18 Left 1076902665 10:133347615-133347637 CCGAGTGCACTTGCCTCTTGGTT 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data
1076902672_1076902676 -7 Left 1076902672 10:133347640-133347662 CCTGGCCTGGTGGAGAATCACCC No data
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data
1076902661_1076902676 29 Left 1076902661 10:133347604-133347626 CCTCTGTGGCCCCGAGTGCACTT 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data
1076902664_1076902676 19 Left 1076902664 10:133347614-133347636 CCCGAGTGCACTTGCCTCTTGGT 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data
1076902662_1076902676 20 Left 1076902662 10:133347613-133347635 CCCCGAGTGCACTTGCCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data
1076902671_1076902676 -6 Left 1076902671 10:133347639-133347661 CCCTGGCCTGGTGGAGAATCACC No data
Right 1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076902676 Original CRISPR ATCACCCAGGGACCCCCACC CGG Intronic