ID: 1076903518

View in Genome Browser
Species Human (GRCh38)
Location 10:133351320-133351342
Sequence ACGCGGGTGGAGGACACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076903518_1076903531 16 Left 1076903518 10:133351320-133351342 CCCCAGGTGTCCTCCACCCGCGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1076903531 10:133351359-133351381 CACACCTGTGACTCTCCCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076903518 Original CRISPR ACGCGGGTGGAGGACACCTG GGG (reversed) Intronic