ID: 1076905254

View in Genome Browser
Species Human (GRCh38)
Location 10:133358010-133358032
Sequence CCCGGCAGACGGGGCGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076905241_1076905254 -4 Left 1076905241 10:133357991-133358013 CCCTTCAGCGCCACCATGGCCCG 0: 1
1: 0
2: 1
3: 4
4: 94
Right 1076905254 10:133358010-133358032 CCCGGCAGACGGGGCGGGCGGGG 0: 1
1: 0
2: 3
3: 28
4: 378
1076905242_1076905254 -5 Left 1076905242 10:133357992-133358014 CCTTCAGCGCCACCATGGCCCGG 0: 1
1: 0
2: 1
3: 23
4: 174
Right 1076905254 10:133358010-133358032 CCCGGCAGACGGGGCGGGCGGGG 0: 1
1: 0
2: 3
3: 28
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076905254 Original CRISPR CCCGGCAGACGGGGCGGGCG GGG Exonic
900123555 1:1059588-1059610 CCCGGCAAGAGTGGCGGGCGCGG + Intergenic
900580331 1:3405557-3405579 TCCCGCAGTCGGGGCAGGCGTGG - Exonic
900665814 1:3814864-3814886 CCCAGCAGACGGGGCCTGCAGGG + Exonic
900694090 1:3999566-3999588 CACTGCCGACGGGGCGGGCATGG + Intergenic
900694120 1:3999684-3999706 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694165 1:3999861-3999883 CACTGCTGACGGGGCGGGCCTGG + Intergenic
900694178 1:3999920-3999942 CACTGCCGACGGGGCGGGCCTGG + Intergenic
901324973 1:8360489-8360511 CCCGGGGGGCTGGGCGGGCGAGG + Exonic
901762213 1:11478801-11478823 CCCTGCAGACGGTCCGGGCCAGG - Intergenic
902366209 1:15975926-15975948 CCCGGGAGCCGGGGCGGAGGCGG - Intronic
902385049 1:16071736-16071758 CCTGGCAGAGGGGGCGGTGGAGG + Intronic
903078109 1:20787344-20787366 CGCGGGAGGCGGGGCCGGCGGGG - Intergenic
903206144 1:21783741-21783763 CGCCGCAGACTGTGCGGGCGGGG + Intergenic
903338022 1:22637731-22637753 CCTGGCAGACGGGGGCGGCCAGG + Exonic
904696773 1:32335679-32335701 CGCGGCACTCGGGGCGGCCGGGG + Intronic
905375080 1:37514597-37514619 GCCTGGAGGCGGGGCGGGCGCGG + Intronic
905449521 1:38047396-38047418 CGCGGGAGGCGAGGCGGGCGCGG - Intergenic
905647198 1:39633019-39633041 CCCCGGGGGCGGGGCGGGCGAGG + Intronic
905912255 1:41662710-41662732 CGCCGGAGCCGGGGCGGGCGCGG - Intronic
906318011 1:44800516-44800538 CCCGGCCGGGGGAGCGGGCGCGG - Exonic
906517506 1:46448314-46448336 CGCGGCAGGCGGGGCGGGAGCGG - Intergenic
906517510 1:46448323-46448345 CCCGGGAGGCGCGGCAGGCGGGG - Intergenic
906678486 1:47709624-47709646 CGCGGCAGAGGGCGCGGGCTAGG + Intergenic
908355807 1:63323922-63323944 CCCGGCAGCGGCGGCGGCCGCGG + Exonic
908850717 1:68373333-68373355 TCCCGCAGGCGGTGCGGGCGGGG - Intergenic
911219678 1:95234015-95234037 CAGGGCAGACGGGGCGGGCGGGG - Intronic
913131089 1:115838875-115838897 CCCGGCAGCCGCGGCGCCCGAGG + Exonic
915458090 1:156053751-156053773 CCGGGCCGGCCGGGCGGGCGGGG - Exonic
915572397 1:156751598-156751620 CCGCACGGACGGGGCGGGCGCGG + Intronic
916265166 1:162883296-162883318 CCAGGCAGACTGGGCGGCCATGG - Intergenic
916605977 1:166343061-166343083 GCCGGGAGGCGGGGAGGGCGGGG + Intergenic
917969805 1:180199258-180199280 CCTGGCAGACTGGGTGGGGGAGG - Exonic
919486857 1:198157106-198157128 CCCGGCGGACGCTGCAGGCGCGG - Exonic
920656190 1:207877125-207877147 CCCGGCAGACGGAGCTTGCAGGG - Intergenic
920705032 1:208244411-208244433 CCGGGCGGACGCGGCCGGCGGGG - Intergenic
921432819 1:215083078-215083100 CCCGGCAGCAGGCGCGCGCGGGG + Intronic
922467977 1:225857370-225857392 CCTGGCCGGCGGGGCGGGGGGGG + Intronic
922513121 1:226186351-226186373 CCGGGCAGAAGCGGCGGGGGTGG + Intronic
924436877 1:244049447-244049469 CCCGGGGGAGGGGGCCGGCGGGG + Intronic
924706584 1:246507320-246507342 CCCGAGGGGCGGGGCGGGCGCGG + Intergenic
1062874213 10:931972-931994 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
1062874218 10:931981-932003 GACGGCGGGCGGGGCGGGCGGGG - Intergenic
1063504084 10:6580389-6580411 CCCGGGAGGCCGGGCTGGCGGGG - Intergenic
1064007201 10:11708091-11708113 CCCCGCACACGGGGAGGGGGCGG + Intergenic
1066022573 10:31318833-31318855 CCGGGCAGCCGCGGCGGGTGTGG + Intronic
1066180747 10:32958411-32958433 CCGGGCTGACGCGGCGGGAGAGG - Intronic
1067437969 10:46292204-46292226 CCCATCAGATGGGGTGGGCGTGG + Intronic
1070156640 10:73839564-73839586 CGCGGCAGGCGAGGCGGGGGCGG + Intronic
1073325916 10:102643992-102644014 CCCGGCTGGCTGGCCGGGCGCGG - Intergenic
1074111190 10:110423804-110423826 ACGGGCAGTCGGGGCGGGAGTGG - Intergenic
1074169574 10:110919479-110919501 CACGGCAGAGGGGTGGGGCGGGG + Intergenic
1076657877 10:132036666-132036688 CATGGCAGAGGCGGCGGGCGGGG - Intergenic
1076885893 10:133262117-133262139 GCCGGGAGACGGGGCGGGGGCGG + Intergenic
1076905254 10:133358010-133358032 CCCGGCAGACGGGGCGGGCGGGG + Exonic
1077021091 11:417446-417468 CCCCGCAGTCAGGGCGGGGGCGG + Intronic
1077090417 11:775854-775876 TCCGGCAGGCAGGGTGGGCGGGG - Intronic
1077093530 11:789983-790005 CGGGGCGGGCGGGGCGGGCGCGG - Intronic
1077093534 11:789992-790014 CCCGGCGGGCGGGGCGGGCGGGG - Intronic
1077106503 11:844634-844656 CCCGCCAGCAGGGGCGGGTGGGG + Intronic
1077217937 11:1402812-1402834 CCCAGCAGAGGAGGCGGGAGCGG + Intronic
1077285457 11:1763487-1763509 CCCTGGAGACGGGGCGGGGCGGG - Intronic
1077299620 11:1840956-1840978 GCGGGCAGGCGGGGCGGGCCGGG + Intronic
1077514148 11:2991850-2991872 CCCCGCACGCGGGGCGGGCTGGG + Intronic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1077922988 11:6655509-6655531 GCCGGCGGGCAGGGCGGGCGCGG + Intronic
1078175025 11:8964039-8964061 CCGGGCAGTCGGGAGGGGCGGGG + Intronic
1078210357 11:9265215-9265237 CACGGCAGCCGCGGCGGCCGAGG - Exonic
1078750787 11:14161567-14161589 CCCGGCACACTGGGAGGCCGAGG - Intronic
1083885742 11:65572684-65572706 CTCGGCAGAGGCGCCGGGCGGGG + Exonic
1083888713 11:65585252-65585274 CCGCGCAGACGGGGCGGCCCCGG + Exonic
1084030913 11:66480157-66480179 CCCGGCAGACGGGACTGACGAGG - Exonic
1084086149 11:66856348-66856370 CCTGGCCCGCGGGGCGGGCGGGG + Intronic
1085453928 11:76655281-76655303 TCCGGCAGAGGAGGCGGGAGAGG + Intergenic
1089433003 11:118437677-118437699 CCTGTAAGACGGGGCGGGGGGGG - Intronic
1090616754 11:128522234-128522256 CCGGGCAGGAGGAGCGGGCGCGG - Intronic
1091309075 11:134560222-134560244 CCAGGCAGCAGGGGCGGGAGGGG - Intergenic
1091740709 12:2959097-2959119 CCCGCCAGGAGGGGAGGGCGCGG + Intergenic
1091975596 12:4822123-4822145 ACTGACAGACGGGCCGGGCGCGG - Intronic
1092195710 12:6548560-6548582 CCCGGGTGTCAGGGCGGGCGGGG + Intronic
1096277499 12:50222649-50222671 CCCGGCAGAGGGAGAGGGAGAGG + Intronic
1096403135 12:51323936-51323958 CCGGGCAGGAGGGGCGGGCAGGG - Intronic
1096496992 12:52044344-52044366 CCCGGCAAGCGGGGCAGGCCAGG - Intronic
1096788908 12:54033332-54033354 CGCTGCAGGCGGGGCGGTCGGGG - Exonic
1097246836 12:57611652-57611674 CCCGGCCGCCGGGCTGGGCGGGG - Intronic
1098991010 12:77065270-77065292 GCTGGCAGCCGGGGCGGGAGTGG + Intronic
1100483615 12:95003685-95003707 CCCGGGAGGCGGGGCCAGCGAGG - Exonic
1101592841 12:106139020-106139042 ACGCGCAGACGGGGCGGGGGCGG + Exonic
1102457171 12:113077964-113077986 CCCGGGAGGCGGCGCGGGCTCGG - Exonic
1102459790 12:113093354-113093376 CCCAGGACACAGGGCGGGCGTGG + Intronic
1103649658 12:122422712-122422734 CCGGGCCGGCCGGGCGGGCGCGG - Intergenic
1103918725 12:124388769-124388791 GCCGGCAGGCTGGGCGGCCGCGG + Intronic
1104854712 12:131896224-131896246 TGCGTCAGACGGGGCGGGGGAGG + Intronic
1105472256 13:20704319-20704341 CCCGGCAGGTGGGGAGGGCAGGG + Intronic
1105472284 13:20704376-20704398 CCGGGCAGGCGGGGAGGGTGGGG + Intronic
1105502879 13:20988334-20988356 CTCCGCAGCCGGGGCGGGGGCGG + Exonic
1107831115 13:44374219-44374241 CCCCGCAGAAGGGGCGGGCCGGG - Intronic
1108220961 13:48233123-48233145 CCTGGGAGGCGGGGCGGGGGCGG - Intergenic
1108313876 13:49220076-49220098 CCCGGGAGAGGGCGCGGGAGCGG + Intergenic
1108408309 13:50125443-50125465 GCCGGGGGAGGGGGCGGGCGCGG - Intronic
1112344297 13:98577167-98577189 CCGGGCCGTGGGGGCGGGCGCGG - Intronic
1112570438 13:100588743-100588765 GCCGGCAGCCGGGGCTGTCGGGG + Intronic
1113861439 13:113490309-113490331 ACGGGCAGTCGAGGCGGGCGAGG - Intronic
1114485092 14:23057440-23057462 CCCGGCGACGGGGGCGGGCGGGG - Exonic
1114524463 14:23359441-23359463 CCAGGCAGGCGGGGTGGGGGTGG + Exonic
1114524557 14:23359739-23359761 GCTGGCAGACGGGGAGGGCGGGG - Exonic
1115028197 14:28766626-28766648 GCCGGCGGGCGGGGCGGGGGTGG + Intergenic
1115545549 14:34462355-34462377 GCCGGCGGCCGGGGCGCGCGCGG - Exonic
1115762030 14:36584387-36584409 CTCTGCAGACGGGGCCGGGGCGG + Intergenic
1117336414 14:54760360-54760382 CCCGGCCGAGGGGGTGGCCGTGG - Exonic
1117899319 14:60515840-60515862 CCCGGCGGACCTGTCGGGCGCGG - Intergenic
1119439671 14:74619728-74619750 CCAGGCTGAGGGGGCAGGCGAGG + Intergenic
1120190572 14:81436246-81436268 CCCCGCAGGTGGAGCGGGCGGGG - Intronic
1120299922 14:82693007-82693029 CCCTGCAGAGGAGGCCGGCGAGG - Intergenic
1121243586 14:92447248-92447270 CCCGGCACTAGGGGCGGGGGAGG + Intronic
1122349124 14:101077581-101077603 CCCGGCAGGCGGGGGCGGAGTGG + Intergenic
1122593196 14:102870455-102870477 GCCGGGCGACGGGCCGGGCGAGG - Intronic
1122789749 14:104179214-104179236 CCTGGGAGGCAGGGCGGGCGGGG - Exonic
1122793789 14:104195550-104195572 TCCTGCAGACGGGGCAGTCGAGG + Intergenic
1122901931 14:104785571-104785593 CCAGGCAGGCAGGGCGGGCAGGG + Intronic
1122993380 14:105249280-105249302 CACGGCGGACGGGGCGGACGGGG - Intronic
1123016238 14:105377012-105377034 CCCTGGAGACGGGGTGGGCAGGG + Intronic
1123047739 14:105526913-105526935 CCCGGGAGGAGGGGCGGGAGGGG - Intronic
1123053618 14:105559421-105559443 GCCGGCAGAAGTGGGGGGCGCGG + Intergenic
1123078197 14:105679836-105679858 GCCGGCAGAAGTGGGGGGCGCGG + Intergenic
1124003692 15:25779947-25779969 GCAGGCAGGCCGGGCGGGCGAGG + Intronic
1127982703 15:64046328-64046350 CGCGGCAGGCGCGGCGGGAGCGG + Intronic
1127982712 15:64046355-64046377 CGCGGCGGGCGCGGCGGGCGCGG + Intronic
1127982715 15:64046364-64046386 CGCGGCGGGCGCGGCGGGCGCGG + Intronic
1128149735 15:65355486-65355508 CGCGGCAGGGGCGGCGGGCGAGG + Intronic
1129673152 15:77618078-77618100 GCCGGCAGCTGGGGCTGGCGCGG + Intronic
1131096216 15:89655576-89655598 GCCCGCAGACAGGGCGGGCGGGG + Intergenic
1132560074 16:589603-589625 CGCCGGCGACGGGGCGGGCGAGG + Intronic
1132586043 16:706083-706105 CGCGGCGGGCGGGGAGGGCGCGG + Intronic
1132588153 16:715142-715164 CGCGGCAGGCGGAGCGGCCGCGG + Exonic
1132684607 16:1157120-1157142 CCCGGCACACGGACGGGGCGGGG + Intronic
1132690018 16:1178100-1178122 CCAGGGAGAGGGGGCGGGGGAGG - Intronic
1132805782 16:1774436-1774458 CCCTGTAGACGGGGCTGGAGGGG + Intronic
1132808711 16:1787645-1787667 CGGGGCAGACGGGGCGGTCAGGG - Intronic
1132915206 16:2340383-2340405 CGCGGCAGGAGGGGCGGGCGCGG + Intronic
1133225296 16:4337884-4337906 CCCAGCAGAGGGGGTGGGTGGGG + Exonic
1135323487 16:21512041-21512063 CCCTGCAGACGGGCCAGGCAAGG + Intergenic
1136254546 16:29029404-29029426 CCCGGCAGCCGGGGGAGGGGTGG + Intergenic
1136564438 16:31061571-31061593 CCCGGCAGCAGGGGCGGGGCTGG - Exonic
1137454712 16:48609684-48609706 CGCGGCGGACGGCGGGGGCGGGG + Intronic
1137926724 16:52547329-52547351 CCCCGGAGAGGGGGCGGCCGCGG - Intronic
1140277239 16:73521479-73521501 CCCTACAGACAGGGCGGGCAGGG + Intergenic
1142022390 16:87791839-87791861 CCCTTCACACGGGGTGGGCGGGG + Intergenic
1142035688 16:87861125-87861147 CCCTGCAGACGGGCCAGGCAAGG + Intronic
1142107861 16:88315895-88315917 GCAGGCAGCCTGGGCGGGCGAGG - Intergenic
1142239771 16:88939952-88939974 CTCGGCGGACGGGTCGGCCGGGG - Exonic
1142367499 16:89657759-89657781 CCCGCCAGAGGGGCGGGGCGCGG + Exonic
1142553010 17:752418-752440 CCCGGAAGAGGGGCCGGGCAGGG - Intronic
1142810249 17:2392801-2392823 CCGGGCAGCCGGGAGGGGCGGGG - Intronic
1142854119 17:2720620-2720642 CCCCTCAGATGGGCCGGGCGTGG - Intergenic
1143025728 17:3941117-3941139 CACGGAAGACGTGGCGGGCAAGG - Exonic
1143223704 17:5282534-5282556 CATGGCAGGCGCGGCGGGCGCGG + Intronic
1143283391 17:5771487-5771509 CACGGAGGTCGGGGCGGGCGGGG - Intergenic
1143369457 17:6429398-6429420 CCCGGCCGGTGGGGCGGGCAGGG - Intronic
1143541600 17:7572735-7572757 GCCGGCAGGCGGGGCCGGGGCGG + Exonic
1143661479 17:8327099-8327121 CCCCGCGGGAGGGGCGGGCGCGG - Intergenic
1145839745 17:27984633-27984655 GCCGGCAGCCGGGGGGGGGGGGG - Intergenic
1145935194 17:28711180-28711202 CCCGGACGCCGGGGCGGGAGCGG - Intronic
1147200758 17:38799734-38799756 CCGGGGAGGAGGGGCGGGCGGGG - Exonic
1147819179 17:43231575-43231597 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147819765 17:43234606-43234628 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147821077 17:43242004-43242026 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147821883 17:43246493-43246515 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147825485 17:43267452-43267474 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147826616 17:43273919-43273941 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147827505 17:43278797-43278819 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147828613 17:43284958-43284980 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147829719 17:43291109-43291131 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147830801 17:43297232-43297254 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147831499 17:43300860-43300882 CCCGGCAGAGGGAGGCGGCGAGG + Intergenic
1147890594 17:43713972-43713994 CCCGGCGCGGGGGGCGGGCGCGG + Intergenic
1148807857 17:50273277-50273299 CCCGGGAGCCGGGAGGGGCGCGG - Intronic
1151556175 17:74847813-74847835 CCCGGCAGGAGGGGTGGGCCTGG - Intronic
1151966930 17:77436457-77436479 CCCCGCAGATGGGACGGGGGCGG + Intronic
1152349860 17:79778452-79778474 CCCGGGCGAGGGGGCGGGAGGGG - Intronic
1152362559 17:79839398-79839420 GCCGGGAGCCGGGGCGGGCGCGG - Exonic
1152706344 17:81845529-81845551 CCCTCCAGACGGGGCTGGGGCGG - Intronic
1153226727 18:2906042-2906064 CCAGGCTGACGGGGGCGGCGGGG + Intronic
1153480689 18:5543660-5543682 CGCGGCGGGCGGAGCGGGCGGGG + Intronic
1154117214 18:11621659-11621681 CCCAGCAGTCTGGGAGGGCGAGG + Intergenic
1157610097 18:48950605-48950627 CCCGGAGGCCGGGGCGCGCGCGG + Exonic
1158427347 18:57352274-57352296 CCCGGCTGAGGGTGCCGGCGAGG - Exonic
1158893270 18:61892983-61893005 CTGGGCAGACGGGGCTGGAGCGG + Exonic
1160631172 18:80247247-80247269 CAGGGCCGCCGGGGCGGGCGGGG + Intronic
1160691833 19:463871-463893 CCCCGCAGGCCGGGAGGGCGTGG + Exonic
1160803485 19:980839-980861 CCCAGCAGACCGGGCAGGTGTGG - Intergenic
1160870763 19:1276788-1276810 CCCGGGAGGCAGGGAGGGCGCGG - Intronic
1160946292 19:1645473-1645495 ACCGGCCGGCGGGGCGGGCTAGG - Intronic
1161111882 19:2475329-2475351 CCAGGCAGCCGGCGGGGGCGGGG + Intergenic
1161153575 19:2721406-2721428 CCCGGCGGGCGGGGACGGCGCGG - Exonic
1161158640 19:2749069-2749091 CCCGGCAGCGTGGGCGCGCGAGG - Intergenic
1161203703 19:3029379-3029401 CCCGGGGGCCGGGGGGGGCGCGG - Intronic
1161312894 19:3604555-3604577 ACAGGCAGGCGGGGCGGGCAGGG - Intronic
1161450666 19:4343724-4343746 CCCGGCGGGCGGTGCGGGCGAGG + Exonic
1161487659 19:4544329-4544351 CCTGGCGCACGGGGCGGGCGAGG - Exonic
1161550592 19:4910125-4910147 CCCGGCGGCGGGGGTGGGCGTGG + Intronic
1161920076 19:7259342-7259364 CGCGGCGGAAGGGGTGGGCGGGG + Intronic
1161959549 19:7516199-7516221 GCCGGCGGCCGGCGCGGGCGCGG + Exonic
1161975628 19:7606538-7606560 CCCTGCAGACGGGGCGGCCCCGG + Exonic
1162298344 19:9828488-9828510 CCCGGGAGAGGGGGCGGATGGGG + Intronic
1162927133 19:13936277-13936299 GCCCGCAGATGGGGCGGGGGAGG + Intronic
1163271002 19:16253890-16253912 CAGGGCAGGCGGGGCGGGGGAGG - Intergenic
1163597071 19:18226380-18226402 CCCGGGGACCGGGGCGGGCGCGG + Intronic
1163828341 19:19535970-19535992 GGCGGCAGCCAGGGCGGGCGCGG - Exonic
1164120556 19:22261751-22261773 CGGGGCGGGCGGGGCGGGCGGGG + Intergenic
1164137537 19:22427955-22427977 CCAGGCAGAGGGAGCGGGTGTGG - Intronic
1164160674 19:22623740-22623762 CCAGGCAGAGGGAGCTGGCGTGG + Intergenic
1165129289 19:33622097-33622119 GCCGGCAGCCGGAGCGTGCGGGG - Intronic
1165305224 19:34999497-34999519 TCTTGCAGACGGGGCGGGGGAGG + Intronic
1165349390 19:35268098-35268120 TCCGGCCGGCGGCGCGGGCGCGG - Intergenic
1165448222 19:35868478-35868500 CCAGGAAGGCGGGGCCGGCGCGG + Exonic
1165461100 19:35944913-35944935 CGGGGCGGGCGGGGCGGGCGTGG - Exonic
1165896714 19:39145808-39145830 CCTGGCAAACAGGGCGGGTGAGG - Intronic
1166367306 19:42284205-42284227 GCCGGCAGCCGGGACGCGCGGGG + Intronic
1166367339 19:42284330-42284352 CGGGGCAGGCGGGGCAGGCGGGG - Intronic
1166367344 19:42284339-42284361 TCCGGCGGGCGGGGCAGGCGGGG - Intronic
1167071728 19:47226130-47226152 CCCGGGCGCCGGGGCGGGCCGGG - Intronic
1167110353 19:47457108-47457130 GCCGGCCGAGGGCGCGGGCGAGG - Exonic
1167466050 19:49651613-49651635 CCCGGCCGCCGGGGCGGAAGAGG - Exonic
1167466141 19:49651897-49651919 AGCGGCGGCCGGGGCGGGCGCGG - Exonic
1167551393 19:50163225-50163247 CCTGGGAGGCGGGGCGGGCCGGG - Intergenic
1167578350 19:50328392-50328414 CCTGGACGACGAGGCGGGCGCGG - Exonic
1168307317 19:55442650-55442672 CCCCGCGGGCGGGGCGGGCGCGG - Exonic
1168401551 19:56088385-56088407 CGCGGCAGCCATGGCGGGCGCGG - Exonic
925355349 2:3237116-3237138 CCTGGGAGATGGGGAGGGCGAGG + Intronic
926092867 2:10061760-10061782 CCAGGCAGACAGGGCAGGGGTGG - Intronic
927168425 2:20348677-20348699 CCCGGCACTCTGGGAGGGCGAGG + Intronic
927472272 2:23385401-23385423 CCCCGCAGCCGCGGCGGCCGCGG - Exonic
927606433 2:24491060-24491082 CCCGGCAGGCCCGGCGGGCTGGG + Intergenic
931487192 2:62705628-62705650 CCCGGCCGCCGAGGTGGGCGGGG + Intronic
932765250 2:74465147-74465169 CCCGGGCGACGGGACGGCCGGGG - Exonic
932773230 2:74513290-74513312 CCCGGGGGCCGGGGCGGGCCGGG + Intergenic
934031846 2:88055534-88055556 CCCGGCGGGCTGGGCGCGCGAGG + Intronic
934079014 2:88452161-88452183 CCCCGCGGGCGCGGCGGGCGAGG + Exonic
934079019 2:88452170-88452192 CGCGGCGGGCGAGGCGGGCGCGG + Exonic
934467092 2:94273028-94273050 CGCGGCAGCGGGGGCGGGGGCGG + Intergenic
934539112 2:95159742-95159764 CTCGGGAGGCGGGGCTGGCGCGG - Intronic
937283690 2:120736840-120736862 CCCAGCAGAGGGGGAGGGGGCGG - Intronic
938302744 2:130228417-130228439 CCCGGGAGAGGAGGAGGGCGAGG - Intergenic
939969535 2:148644555-148644577 CCGGGGAGAGGGGGCGGGGGCGG - Intronic
940317000 2:152336178-152336200 CCCGGCAGATGGGGCGCATGTGG + Intronic
941384923 2:164841346-164841368 CCCGGGAGGCGGGCCGGCCGGGG - Exonic
941752672 2:169149584-169149606 CCCAGCACACTGGGAGGGCGAGG + Intronic
942116788 2:172735897-172735919 CGCGGCGGACGAGGCGGGGGCGG + Exonic
944114501 2:196171844-196171866 CGCTGCAGAGGGGGCGCGCGGGG + Intronic
945955738 2:216084170-216084192 CCAGGCAGATGGGGTGGGGGAGG - Intronic
946721349 2:222611838-222611860 CCAGGCAGAGGGTGCGGGTGAGG - Intronic
947715414 2:232336648-232336670 ACAGGCAGGCGGGGCAGGCGGGG - Exonic
948922190 2:241071024-241071046 CCAGGCAGAAGGGGCAGGCTGGG + Intronic
949079899 2:242088521-242088543 CCCGGCACTCTGGGCGCGCGCGG + Intergenic
1168831008 20:845277-845299 CCGGGCAGGCGAGGCGGGCAGGG - Exonic
1169247370 20:4034148-4034170 CGCAGCAGCCGGGGCTGGCGTGG - Intergenic
1171810134 20:29740893-29740915 CCCGGCAGGCGGGGGGCGGGCGG + Intergenic
1172644483 20:36461396-36461418 CGCGGCTGACGCGGGGGGCGGGG + Intronic
1172954676 20:38748040-38748062 CCCGGCCGACGGTGCGCGCCCGG + Intergenic
1172954681 20:38748058-38748080 CCCGGCCGACGGTGCGCGCCCGG + Intergenic
1173279838 20:41618250-41618272 CCCGGCCGGCGGGGCGGGGCCGG + Intronic
1174528300 20:51191092-51191114 AGCGGCAGATGGGGCCGGCGCGG + Intergenic
1175429500 20:58891616-58891638 CCGGGCGGGCGGGCCGGGCGCGG - Intronic
1175553449 20:59831625-59831647 CCCTGCAGAGGGGTGGGGCGGGG - Intronic
1175767880 20:61603622-61603644 CTGGGCAGACGGGGTGGGCATGG - Intronic
1175847035 20:62064851-62064873 CCCGGCGGCCGGGGCGGGGGCGG + Exonic
1175870738 20:62208356-62208378 CCCAGCACACGGGGTGGGGGGGG - Intergenic
1175927053 20:62476074-62476096 CGGGGAAGAAGGGGCGGGCGCGG - Intergenic
1175934373 20:62508268-62508290 CCCAGCAGAGGGGGTGGGTGGGG + Intergenic
1175955533 20:62607079-62607101 ACTGGGAGACGGGGCGGGGGCGG + Intergenic
1175960578 20:62634523-62634545 CCCGGCAGGCAGGGCAGGCTAGG - Intergenic
1176108860 20:63402046-63402068 CCCGGCAGACGTGGTGTGAGAGG - Intergenic
1176108898 20:63402221-63402243 CCCGGCAGACGTGGCGTGAGAGG - Intergenic
1176242127 20:64080027-64080049 CGCGGCGGGCGGGGCGGGCCCGG - Intergenic
1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG + Intronic
1178839870 21:36130052-36130074 CCCCGCGGCGGGGGCGGGCGCGG + Intergenic
1179971447 21:44838276-44838298 CCAGGCAGCCGGAGCGGGCAGGG + Intergenic
1180008192 21:45032989-45033011 CCCTGGAGACTGGGCGGGGGTGG - Intergenic
1180180295 21:46115941-46115963 GGCTGCAGGCGGGGCGGGCGTGG - Intronic
1180614966 22:17120934-17120956 GGCGGCAGACGCGGCGGGGGCGG - Exonic
1182304686 22:29359687-29359709 GCCTGCAGGCTGGGCGGGCGCGG + Intronic
1183535707 22:38399174-38399196 CCCGGCGGGGGGGGCGGGGGGGG + Intergenic
1184094493 22:42309279-42309301 CCCAGCTGACAGGGCAGGCGGGG - Intronic
1184200741 22:42967596-42967618 CCCTGCAAATGGGCCGGGCGCGG + Intronic
1184265249 22:43342986-43343008 CCCCGCAGCCCGGGCGGCCGGGG - Intronic
1184362106 22:44024723-44024745 CCCGGCAGGCAGAGCAGGCGCGG - Intronic
1184581081 22:45418261-45418283 CCCCGCAGACTGGGAGGGCAGGG - Intronic
1184618946 22:45659391-45659413 CCCTGCAGACAGGCCGGGCGCGG - Intergenic
1184900563 22:47444089-47444111 CCTGGCAGAGGGGGAGGGAGGGG + Intergenic
1185055397 22:48576245-48576267 CGCCGCGGAGGGGGCGGGCGGGG - Intronic
1185313929 22:50170690-50170712 CCCGGCGGGGGGCGCGGGCGGGG - Intergenic
1185333354 22:50261343-50261365 GGCGGCCGGCGGGGCGGGCGGGG - Intronic
1185409600 22:50674817-50674839 CCCGGCGGAGGCGGCGGGGGAGG - Intergenic
953020787 3:39111896-39111918 CCAGGCAGATGGGGAGGGCCAGG - Intronic
953027463 3:39153317-39153339 CCCGGCACCCTGAGCGGGCGCGG - Intronic
953672696 3:44976126-44976148 CCCGGCAGTGGCGGCGGCCGCGG + Exonic
954199930 3:49018145-49018167 CGAGGCAGGCGAGGCGGGCGTGG + Exonic
954404927 3:50340459-50340481 CGCGGCAGAGGGGGTCGGCGGGG - Intronic
954444499 3:50539556-50539578 CCCGGGAGACGGGGGTGGGGAGG + Intergenic
956468635 3:69542622-69542644 CCCCGGAGAGGCGGCGGGCGGGG - Intergenic
961365167 3:126394996-126395018 CCGGGGAGAGGGGGCGCGCGGGG + Intronic
962156828 3:132956831-132956853 CCAGGCACACGGGGCAGGGGCGG - Intergenic
962498477 3:135965935-135965957 CGCGGAGGCCGGGGCGGGCGGGG + Intronic
966596249 3:181726695-181726717 TGCGGCAGCCGGGGCTGGCGTGG + Intergenic
966787848 3:183636461-183636483 CCGGGGAGCCGGGGCGGGCGGGG + Intronic
966854691 3:184186046-184186068 CCCGGTGGGCGGGGCGAGCGGGG - Exonic
967176490 3:186865652-186865674 CGCAGCAGCCGGGGCTGGCGTGG - Intergenic
967684875 3:192408173-192408195 TCCGGCAGAAGCGGCAGGCGAGG - Exonic
967849466 3:194071114-194071136 GCGGGGAGACGCGGCGGGCGCGG + Intergenic
968428084 4:536145-536167 CCCCGCAGACTCGGCGGGCCCGG + Intronic
968610317 4:1554085-1554107 CCTGGCAGCCGGGGAGGGGGTGG - Intergenic
968610328 4:1554108-1554130 CCTGGCAGCCGGGGAGGGAGTGG - Intergenic
968756486 4:2418701-2418723 CGCTGCGGGCGGGGCGGGCGGGG + Intergenic
969344583 4:6563128-6563150 CCCGGCTGAAGGTGCGGGCGCGG - Intronic
972418770 4:38867772-38867794 CCCTGCAGACGTGGCGGGGCGGG + Intronic
973317688 4:48779519-48779541 CCCGGCGGGCAGGGCTGGCGGGG - Intronic
976282027 4:83334971-83334993 CCGGGCAGGCGGGGCGGGGTTGG - Intronic
978572384 4:110152518-110152540 CCTGGCAGAAAGGCCGGGCGTGG - Intronic
979625737 4:122843253-122843275 CCAGGCAGACAGGGCGGGGAAGG + Intronic
981615250 4:146638482-146638504 CCCGGCAGAAGAAGCGGGAGGGG + Intergenic
982564691 4:156971957-156971979 GGCGGCCGATGGGGCGGGCGGGG + Intergenic
985550109 5:528573-528595 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
985643339 5:1073866-1073888 CAGGGCAGATGGGACGGGCGGGG + Intronic
985660857 5:1155914-1155936 CGGGGCCGGCGGGGCGGGCGCGG + Intergenic
986402837 5:7396188-7396210 GCCGGCAGCCGGGCCGGCCGAGG + Exonic
990410386 5:55535195-55535217 CTCGGCAGCCGGGCGGGGCGTGG + Intergenic
990753118 5:59039432-59039454 CTCGGCAGGCGGGGCGGGCGTGG - Intronic
993495412 5:88603235-88603257 GCCGGGGGAGGGGGCGGGCGGGG - Intergenic
998369494 5:141651566-141651588 TCCGGGTGGCGGGGCGGGCGGGG + Intergenic
999259644 5:150230027-150230049 CCTGGCAGGCCGGGCGGGCTCGG + Intronic
1002196893 5:177506026-177506048 CCCGGGAGGCGGGCTGGGCGCGG - Intronic
1002482030 5:179508002-179508024 CCCAGCACACGGGGAGGCCGAGG + Intergenic
1002662779 5:180802850-180802872 CCCGGCAGGCGGGGCGGGGCGGG + Intronic
1002888970 6:1317396-1317418 CTCGGCCGACGCGGGGGGCGCGG + Intergenic
1005040458 6:21595634-21595656 CGCGCTGGACGGGGCGGGCGAGG - Exonic
1005860403 6:29895979-29896001 CCTCTCAGACGGGGCGGCCGGGG + Intergenic
1006180428 6:32150641-32150663 CCCGGCAGCAGGGCCGGGAGGGG + Exonic
1006257792 6:32844924-32844946 AGTGGCAGATGGGGCGGGCGCGG - Intronic
1011640440 6:89412194-89412216 GCCGGCGGGCGGGGCGGGGGAGG - Exonic
1015965697 6:138693438-138693460 CCCGGCCCGGGGGGCGGGCGAGG - Intergenic
1016783717 6:147988020-147988042 CCAGGCAGACCGGGCAGGAGTGG - Intergenic
1017206463 6:151808369-151808391 CCCGACGGGCGGCGCGGGCGCGG - Intronic
1018945633 6:168345678-168345700 CCCGGCCGGCGGGGCAGCCGAGG + Intergenic
1019409947 7:901975-901997 CCGGGCAGACGGGGCATGCCTGG + Intronic
1019513864 7:1431284-1431306 CCCGGCAGCCGGAGCGGAGGGGG + Intronic
1019662524 7:2232710-2232732 CATGGGAGACGGGGCGGGCGCGG + Intronic
1019707358 7:2502918-2502940 CCCGGGAGATGGGGGGAGCGAGG + Intergenic
1020113190 7:5459488-5459510 CCCAGCACACTGGGCGGCCGAGG + Intronic
1020137278 7:5594291-5594313 CCGGGCAGACGGGGAGGTGGAGG - Intronic
1020204707 7:6105360-6105382 CCAGGCCGAAGGGGCGGGCTGGG - Intronic
1020445329 7:8262007-8262029 CCCGGCAGCCGGGACGGTCGGGG - Intronic
1020552284 7:9621699-9621721 CCGGGCCGGCGGGGCCGGCGGGG + Intergenic
1023857420 7:44193213-44193235 ACCAGCAGACGGGGAGGGAGGGG - Intronic
1023881939 7:44325674-44325696 GGCGGCGGGCGGGGCGGGCGCGG - Intronic
1024732990 7:52273781-52273803 CCCTGCAGGCGGAGCGGGCTCGG + Intergenic
1024975477 7:55110395-55110417 CCCCGCAGACCGGGCAGGCTTGG - Intronic
1025853597 7:65260307-65260329 CGCAGCAGCCGGGGCTGGCGTGG - Intergenic
1027421190 7:78019602-78019624 GGCGGCAGACGCGGCGGACGCGG - Exonic
1029273495 7:99391055-99391077 CCAGGCAGACGGTGCTGTCGTGG - Exonic
1032194700 7:129782042-129782064 TCCGGCCGTCGGAGCGGGCGGGG + Intergenic
1034344718 7:150379289-150379311 CGGGGCAGGCGGGGCGGGCACGG - Intronic
1034434715 7:151057931-151057953 GCGGGCAGACGGGGCGGGGCTGG - Exonic
1034622079 7:152464040-152464062 CCCGGAAGGCGGTGGGGGCGGGG + Intergenic
1035023527 7:155812293-155812315 CCCCGCAGCCGCGGCGGGCAAGG - Intergenic
1035328983 7:158084287-158084309 CACAGCAGACGTGGCGGGCGGGG - Intronic
1035412415 7:158655725-158655747 CCAGGCAGATGGGGAGGACGGGG - Intronic
1035971704 8:4256682-4256704 CCCAGCAGATGGGCCGGGCGTGG + Intronic
1036165550 8:6429494-6429516 CCTGGCAGCTGGGGCGGGGGAGG - Intronic
1037887085 8:22600874-22600896 CCATGCAGATGGGGCTGGCGAGG + Exonic
1038566250 8:28622498-28622520 CCCGGGAGCCGGCGAGGGCGGGG + Intronic
1047961768 8:130016369-130016391 CCTGGCGGCCCGGGCGGGCGAGG + Intronic
1049396432 8:142403140-142403162 CACGGCGGGCGAGGCGGGCGGGG + Exonic
1049554680 8:143275946-143275968 CCCTGACGAGGGGGCGGGCGGGG + Exonic
1049687474 8:143944686-143944708 CGGGGCAGACGGAGCGGGCCAGG + Intronic
1049716276 8:144094677-144094699 CCCGGCAGAGGGCGCGGGCAGGG - Intergenic
1049838522 8:144755345-144755367 GCAGGCAGGCGGGGAGGGCGCGG - Intronic
1049891482 9:73837-73859 CCAGGGAGACGGGACGGGCCTGG - Intergenic
1053381203 9:37650890-37650912 GCCGCCAGACGGCGCGGGCGCGG + Intronic
1056588542 9:87944965-87944987 CGCGGCATCCGGGGTGGGCGGGG + Intergenic
1057207814 9:93184132-93184154 CCCGGCGCGCGGGGAGGGCGGGG - Intergenic
1057207872 9:93184333-93184355 CCCGGCGGCCAGGGCGTGCGAGG - Intergenic
1057479439 9:95433168-95433190 TGTGGCAGACGGGGCGGGGGGGG + Intergenic
1058176159 9:101738275-101738297 CCCTGCAGATGGGGCGGGCAGGG - Exonic
1058467527 9:105244521-105244543 CCCGGGAGAGGGAGCGGGAGAGG + Intergenic
1059102331 9:111483339-111483361 CCTGGCGGACGGGCGGGGCGCGG - Intronic
1059433084 9:114261357-114261379 TCCAGCAGGCGGGGCGGGGGTGG + Intronic
1060139838 9:121201066-121201088 CCCTGCAGCCGGGCCGGGCCGGG - Intronic
1060662123 9:125410762-125410784 GCCGGCAGAAGGGGCAGGAGGGG + Intergenic
1060849227 9:126860786-126860808 CGGGGCAGGCGGGGCAGGCGGGG + Intronic
1060855925 9:126915021-126915043 CGCGGCCGACGGGGCGGGGCGGG + Intronic
1061540788 9:131277109-131277131 CGCCACTGACGGGGCGGGCGCGG - Intergenic
1061583980 9:131554759-131554781 CCCGGCCCAGGCGGCGGGCGAGG + Intergenic
1061803882 9:133127641-133127663 CCCGGCACAGCGGGCGGGCCTGG + Intronic
1061975975 9:134068185-134068207 CCGGGTCGGCGGGGCGGGCGGGG - Intronic
1062055775 9:134469157-134469179 CCGGGCACACCGGGCGGGGGAGG - Intergenic
1062169765 9:135128498-135128520 CCAGGCAGGCGGGGGGAGCGTGG + Intergenic
1062433632 9:136536494-136536516 GCAGGCAGACTGGGCGGGTGGGG + Intronic
1062449961 9:136611098-136611120 CCAGGCAGGGGGGGCGGCCGTGG + Intergenic
1062449979 9:136611135-136611157 CCAGGCAGGGGGGGCGGCCGTGG + Intergenic
1062449996 9:136611171-136611193 CCAGGCAGGGGGGGCGGCCGTGG + Intergenic
1062513674 9:136921559-136921581 CCAGGAAGACAGGGCGGGTGGGG + Intronic
1062527304 9:136983160-136983182 CCAGTCAGACGGAGCGGGTGAGG - Exonic
1062533847 9:137013066-137013088 CGAGTCAGATGGGGCGGGCGAGG + Exonic
1062584177 9:137241580-137241602 CCCGGCGGCCAGGGCGCGCGGGG + Intronic
1062629970 9:137459144-137459166 CCCGGCGGAGGCGGCGGGCGCGG - Exonic
1185464527 X:346606-346628 TTCTGCGGACGGGGCGGGCGGGG - Intronic
1185508313 X:644651-644673 CCCGGGAGTCCGGGCGCGCGGGG - Exonic
1190267331 X:48835314-48835336 CCCGGGAGCCGGCTCGGGCGGGG + Intronic
1199500372 X:148500681-148500703 CGCGGCAGCCGGGGCGGCAGCGG - Exonic
1200214065 X:154359686-154359708 GCTGGCAGACGGGGTGGGTGGGG - Intronic