ID: 1076909526

View in Genome Browser
Species Human (GRCh38)
Location 10:133379988-133380010
Sequence TCCCCTCGCAGGTGGCGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076909522_1076909526 -6 Left 1076909522 10:133379971-133379993 CCAGGTGGCATCTGCTGTCCCCT 0: 1
1: 1
2: 1
3: 41
4: 359
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195
1076909518_1076909526 13 Left 1076909518 10:133379952-133379974 CCTTCTAGGAAAGGGACCTCCAG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195
1076909521_1076909526 -3 Left 1076909521 10:133379968-133379990 CCTCCAGGTGGCATCTGCTGTCC 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195
1076909517_1076909526 14 Left 1076909517 10:133379951-133379973 CCCTTCTAGGAAAGGGACCTCCA 0: 1
1: 0
2: 2
3: 5
4: 129
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076909526 Original CRISPR TCCCCTCGCAGGTGGCGTGG TGG Exonic
900298508 1:1964942-1964964 TCCACAAGCAGGTGGTGTGGGGG - Exonic
900473244 1:2864631-2864653 TCCCCAGGCAGCTGGGGTGGGGG + Intergenic
901532665 1:9863435-9863457 TCTCCCCGCATGTGGCTTGGAGG - Intronic
902629332 1:17695406-17695428 TCTCATCTCAGGTGGCATGGTGG + Intronic
903485803 1:23688759-23688781 TCACCTCCCAGGTGGGATGGCGG - Intergenic
904466600 1:30711779-30711801 TCCCCACACAGGTGGGGAGGGGG - Exonic
905653725 1:39672680-39672702 GCCCCTCCTAGGTGGTGTGGAGG - Intergenic
905673421 1:39808180-39808202 TCACCTCCCAGATGGGGTGGCGG - Intergenic
905680838 1:39869753-39869775 TCACCTCCCAGATGGGGTGGCGG - Intronic
907275444 1:53314357-53314379 TCCCCTAGCATGGGGCCTGGTGG - Intronic
907425119 1:54374671-54374693 TCCCCTGCCAGGTGGGGTGGGGG - Intronic
908038354 1:60080699-60080721 TCCCCCAGCATGTGGCCTGGGGG - Intergenic
910224943 1:84926996-84927018 TCCCCTCCCTGGGGGCATGGAGG - Intronic
915141435 1:153770946-153770968 TGCCCTCGGAGGTGGGGAGGTGG + Intronic
915992576 1:160532053-160532075 TCACCTCCCAGATGGGGTGGCGG - Intergenic
916671943 1:167029700-167029722 TCACCTCCCAGATGGGGTGGCGG - Intergenic
920143920 1:203841908-203841930 TCACCTCCCAGATGGGGTGGCGG + Intronic
923880144 1:238095034-238095056 TCCCCTTGGGGGTGGCATGGGGG + Intergenic
923880155 1:238095066-238095088 TCCCCTTGAGGGTGGCATGGGGG + Intergenic
1064241228 10:13631329-13631351 TCCCGGAGCAGGTGGAGTGGTGG + Intronic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1066140528 10:32500355-32500377 TCACCTCCCAGATGGGGTGGTGG + Intronic
1067117439 10:43446465-43446487 TCACCTCCCAGATGGGGTGGTGG + Intronic
1067333968 10:45346784-45346806 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1067333981 10:45346824-45346846 TCACCTCCCAGATGGGGTGGTGG - Intergenic
1067334188 10:45347585-45347607 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1067334298 10:45348009-45348031 TCACCTCCCAGATGGGGTGGTGG - Intergenic
1070807536 10:79279272-79279294 TCACCTCCCAGATGGGGTGGTGG + Intronic
1072782298 10:98259170-98259192 TCCCCAGGCAGGTGACCTGGTGG + Exonic
1075243376 10:120798629-120798651 TCACCTCCCAGACGGCGTGGCGG - Intergenic
1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG + Exonic
1077105495 11:840580-840602 TCGCCTTGCCGGTGGCGGGGGGG - Intronic
1080648518 11:34204559-34204581 TGCCCACGCAGGTGGCCAGGAGG + Exonic
1081871094 11:46382796-46382818 TCCCCTCACAGGCGGGGGGGGGG - Intronic
1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG + Intronic
1083120782 11:60510290-60510312 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1085396162 11:76208191-76208213 GCGCCACGCAGGTGGCGTCGCGG - Intronic
1089865285 11:121626292-121626314 TCCCCTTGGAAGTGGGGTGGGGG + Intronic
1092384696 12:8027059-8027081 TCCCCGCGCCGGTGGAGTAGGGG + Intergenic
1093763039 12:22931803-22931825 CCACCTCACAGGTGTCGTGGTGG - Intergenic
1094846518 12:34363790-34363812 TCCCCACGCATGTGCCGTGGGGG + Intergenic
1098130088 12:67341223-67341245 ACACCTCCCAGGTGGGGTGGCGG + Intergenic
1100048212 12:90411141-90411163 TCACCTCCCAGGCGGGGTGGCGG - Intergenic
1101371679 12:104137467-104137489 TCCCCACGCAGGTGCCTGGGTGG + Intronic
1102900351 12:116631760-116631782 GCCCCTCCCAGGTGGGGAGGAGG + Intergenic
1103869770 12:124083120-124083142 TCCCCTTTCAGATGGCCTGGAGG + Intronic
1103932457 12:124457879-124457901 TCCACTCACAGGAGGCCTGGAGG + Intronic
1104858578 12:131913187-131913209 TCCCCCTGCAGGTGACCTGGTGG + Exonic
1106747687 13:32721552-32721574 TCACCTCCCAGATGGGGTGGCGG + Intronic
1107562683 13:41572035-41572057 TCACCTCCCAGATGGGGTGGTGG - Intronic
1108350292 13:49585432-49585454 TGACCTCGCAGGTAGCGTGTGGG - Exonic
1114401466 14:22414674-22414696 TCCCATTGGAGGTGGAGTGGGGG + Intergenic
1114670825 14:24410057-24410079 TTCGCTTGCAGGTGGCGAGGTGG - Exonic
1117010650 14:51467636-51467658 TCACCTCCCAGATGGGGTGGTGG + Intergenic
1119722051 14:76898217-76898239 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1120193793 14:81462564-81462586 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1120979517 14:90277967-90277989 TCCCTCCGCTGGTGTCGTGGTGG - Exonic
1121208285 14:92187692-92187714 TCACCTCCCAGATGGGGTGGTGG + Intergenic
1121208330 14:92187846-92187868 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1122328082 14:100894688-100894710 TGCCCTCCCAGGTGGCGTGAAGG + Intergenic
1122411071 14:101526488-101526510 TCACCACGCAGATGGAGTGGTGG - Intergenic
1122773381 14:104106849-104106871 TGCCCACGCCGGTGACGTGGAGG + Exonic
1124664644 15:31581748-31581770 TCCCATCACAGGAGGCCTGGAGG - Intronic
1125031828 15:35082176-35082198 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1126705712 15:51403022-51403044 GCCACACGGAGGTGGCGTGGGGG + Intronic
1128764802 15:70244510-70244532 TGCCCTGGCAGGTGGCTTGGGGG - Intergenic
1128845580 15:70891973-70891995 TCCCCTCTTAGGTGCCGGGGCGG + Exonic
1132349851 15:101132929-101132951 TCCCCTCGAGTGTGGAGTGGAGG - Intergenic
1132942941 16:2517300-2517322 GCACCTCCAAGGTGGCGTGGAGG + Intronic
1135627688 16:24010461-24010483 TCCCCTCCGATGTGGGGTGGGGG - Intronic
1136348930 16:29694769-29694791 GCCCCTCGCAGGCGGCGCTGTGG + Exonic
1137439095 16:48483271-48483293 TCACCTCCCAGATGGGGTGGTGG + Intergenic
1138221562 16:55256086-55256108 TCCCCACTGAGATGGCGTGGTGG - Intergenic
1139093698 16:63679775-63679797 CCCCCTCACAGGTTGGGTGGCGG + Intergenic
1141695066 16:85615201-85615223 GCCCCTCACCTGTGGCGTGGCGG - Intronic
1143130564 17:4674551-4674573 TCCCCTTTCCGGTGGCTTGGCGG + Exonic
1144789780 17:17850984-17851006 TCCCCTCGCTGGCTGTGTGGGGG - Intronic
1145087034 17:19950996-19951018 TCACCTCCCAGATGGGGTGGCGG - Intronic
1148796656 17:50200392-50200414 TCCCTGGGCAGGTGGGGTGGCGG + Intronic
1152690489 17:81715751-81715773 TGGCCTTGCAGGTGGGGTGGGGG - Intronic
1154003518 18:10506493-10506515 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1154115946 18:11613490-11613512 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1154116008 18:11613727-11613749 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1160295608 18:77634035-77634057 TCCATTGGCAGTTGGCGTGGGGG + Intergenic
1160785140 19:896797-896819 CCCCGACACAGGTGGCGTGGGGG + Exonic
1160967847 19:1754350-1754372 TCCCCAGCCAGGTGGCCTGGCGG - Exonic
1163715021 19:18868445-18868467 GCCTCTGGCAGGTGGCCTGGAGG + Intergenic
1163831036 19:19547282-19547304 TCCCATCCCAGGTGCCCTGGAGG - Intergenic
1163865532 19:19770179-19770201 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1164012161 19:21212749-21212771 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1164016542 19:21260055-21260077 TCACCTCCCAGATGGGGTGGTGG + Intronic
1164016752 19:21260895-21260917 TCACCTCCCAGATGGGGTGGCGG + Intronic
1164028695 19:21380421-21380443 TCCCCTGGCCTGTGGAGTGGGGG + Intergenic
1164231229 19:23290197-23290219 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1166990485 19:46689865-46689887 GCACCTGGCAGGTGGGGTGGAGG - Intronic
1167179986 19:47895631-47895653 TCCCTTTGCAGGTGGGATGGCGG - Intergenic
1167774737 19:51547414-51547436 TACCCTCCCAGGTGTCCTGGGGG - Intergenic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
929573896 2:43040275-43040297 TCTCCCCACTGGTGGCGTGGTGG - Intergenic
929966859 2:46542882-46542904 TCCCCTCGCAGGAGGGGAGGGGG - Exonic
930048326 2:47193309-47193331 TTCCCTAGCAGGTGGCGGGGAGG - Intergenic
932410188 2:71542888-71542910 ACACCTCGCAGATGGGGTGGCGG + Intronic
932903461 2:75725266-75725288 ACCCCTCCCAGATGGGGTGGTGG - Intergenic
936863863 2:117055609-117055631 CCCCCTCGCAGGGCGCGCGGCGG + Intergenic
938301101 2:130213636-130213658 TCCCCTCGCCGGAGGGGAGGGGG + Intergenic
938455615 2:131460831-131460853 TCCCCTCGCCGGAGGGGAGGGGG - Intergenic
938934371 2:136116281-136116303 GCCACTCCCAGGCGGCGTGGGGG + Intronic
943100316 2:183479197-183479219 TCACCTCCCAGATGGGGTGGCGG - Intergenic
943323423 2:186472936-186472958 TCACCTCCCAGATGGGGTGGCGG - Intergenic
943571109 2:189576524-189576546 TCCCCGGGGAGGTGGGGTGGGGG - Intronic
945225801 2:207530227-207530249 TCCCCTCGCAGGAGGGGCCGCGG + Intronic
946154089 2:217795929-217795951 TCCCCTCCCATCTGGAGTGGAGG - Intergenic
947827934 2:233118752-233118774 TCCCCTCGGAGGGGGAGAGGTGG + Intronic
948273416 2:236690931-236690953 TCCTCTCCTAGGTGGGGTGGAGG + Intergenic
948930318 2:241127776-241127798 TCCCCTTGCAGGTGGGGCCGAGG - Intronic
1169788439 20:9385452-9385474 TCACCTCCCAGATGGGGTGGCGG + Intronic
1169788489 20:9385645-9385667 TCACCTCCCAGATGGGGTGGTGG + Intronic
1172276723 20:33684154-33684176 GCCCCTGACAGGTGGAGTGGAGG + Intronic
1172337870 20:34132492-34132514 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1173571051 20:44076325-44076347 TCACCTGGTAGGTGGCGGGGGGG - Intergenic
1175834141 20:61982668-61982690 TCTCCTCTCAGGTGGGGTGTGGG - Intronic
1175888883 20:62307360-62307382 GCCCCTCGCAGGTGGGCTGGGGG + Exonic
1176123349 20:63464170-63464192 GCCTCTCGCAGGGGGAGTGGTGG - Intronic
1176386974 21:6142987-6143009 TCCCTCCGCTGGTGGCCTGGAGG + Intergenic
1179566600 21:42252872-42252894 TCCCCGCCCAGGTGGTGTTGGGG + Intronic
1179736499 21:43395265-43395287 TCCCTCCGCTGGTGGCCTGGAGG - Intergenic
1180285472 22:10741587-10741609 TCCCGGAGCAGGAGGCGTGGAGG + Intergenic
1181296949 22:21847643-21847665 TCACCTCCCAGATGGGGTGGCGG - Intronic
1183507970 22:38219947-38219969 TCTCCTCACAGGTGGCAGGGAGG + Exonic
1183717715 22:39543627-39543649 TCCTTTGGCAGGTGGAGTGGTGG + Intergenic
1183740640 22:39666776-39666798 TCCCCTCCCAGGTGCCATTGTGG - Intronic
950189446 3:10966454-10966476 CACCCTGGCAGGTGGGGTGGAGG + Intergenic
951906423 3:27712339-27712361 TCCCCACACAGTTGGAGTGGAGG - Intergenic
953440171 3:42909777-42909799 TCACCTCCCAGATGGCGTGGCGG + Intronic
955403240 3:58608688-58608710 CCCCCTTGGAGGTGGCATGGGGG + Intronic
956803828 3:72788361-72788383 TCACCTCCCAGATGGGGTGGCGG - Intronic
958406780 3:93763081-93763103 TCACCTCCCAGATGGGGTGGTGG + Intergenic
960991251 3:123313149-123313171 TCCCCTGGCAGGTGCAGAGGTGG - Intronic
961452136 3:127007067-127007089 TCCCGTCCCAGGTGGGGTGGGGG + Intronic
962095035 3:132284805-132284827 TCCCCTCGCAGGGCGTGTGACGG + Intronic
962761835 3:138521608-138521630 TCACCTCCCAGATGGGGTGGCGG - Intronic
966350988 3:179032689-179032711 TCACCTCCCAGATGGGGTGGTGG - Intronic
968731171 4:2270046-2270068 TCCCCTTGCTGATGGCATGGGGG - Exonic
969414095 4:7047635-7047657 TCACCTGGCAGGTGCCGTGTGGG + Intronic
969694909 4:8729041-8729063 TGCACTGGGAGGTGGCGTGGGGG + Intergenic
969756478 4:9153381-9153403 TCCCCTGGCAGGTGGCCGGCGGG + Intergenic
971282100 4:25249646-25249668 TCACCTCCCAGATGGGGTGGCGG + Intronic
973650418 4:52992674-52992696 TCACCTCCCAGATGGGGTGGCGG - Intronic
975908810 4:79245470-79245492 TCACCTCCCAGATGGGGTGGCGG - Intronic
975908833 4:79245550-79245572 TCACCTCCCAGATGGGGTGGCGG - Intronic
981495344 4:145385642-145385664 TCCTCTGGCATGTTGCGTGGGGG - Intergenic
982315169 4:154024321-154024343 TCCCCTCGCAGGGCACGTGATGG - Intergenic
985023159 4:185712819-185712841 CCCCCTCGCAAGTGCCGTGAAGG + Intronic
985675206 5:1227328-1227350 TCCCCGCGCAGCTGGCGGGCAGG - Intronic
985926651 5:3024667-3024689 TTCCCTCGCAGCTGGCGGTGGGG + Intergenic
988557788 5:32253064-32253086 TCCCCTCGTGGGTGGGGTGGGGG - Intronic
990501107 5:56397964-56397986 TCACCTCCCAGATGGGGTGGCGG + Intergenic
990709144 5:58563404-58563426 TCACTTCTCAGGTGGGGTGGCGG + Intergenic
991376896 5:65977033-65977055 ACACCTCGCAGATGGGGTGGTGG + Intronic
992008531 5:72503718-72503740 TGCCCTCTCATGTGGCTTGGTGG - Intronic
993900319 5:93580236-93580258 TCCCCTCCAAGGAGGCGCGGCGG + Intergenic
996057676 5:118999065-118999087 TCACCTCCCAGATGGGGTGGCGG - Intergenic
997445806 5:133939374-133939396 TCCACTCTGAGGTGGGGTGGGGG - Intergenic
999174040 5:149619087-149619109 TCCCCTGGCAGGAGGCTTGCAGG + Intronic
999979051 5:156940640-156940662 TCACCTCCCAGATGGGGTGGTGG - Intronic
1000103459 5:158037306-158037328 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1001075518 5:168624777-168624799 TCTCCTGGGAGGTGGAGTGGGGG - Intergenic
1007632020 6:43277827-43277849 TCTCCTCGCAGGTGGAGCAGGGG + Intronic
1008106380 6:47444198-47444220 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1009392946 6:63164632-63164654 TCACCTCCCAGATGGGGTGGTGG - Intergenic
1009844751 6:69121685-69121707 TCACCTCCCAGATGGGGTGGCGG + Intronic
1009844795 6:69121844-69121866 TCACCTCCCAGATGGGGTGGCGG + Intronic
1009868917 6:69432468-69432490 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1009868930 6:69432508-69432530 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1013800101 6:113932157-113932179 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1019641672 7:2106720-2106742 TCCTCTCTCAGGTTTCGTGGAGG - Intronic
1019705413 7:2495035-2495057 GCCCCTCACAGGTGCAGTGGAGG - Intergenic
1020075224 7:5253397-5253419 GTCCCTCGCAGTTGGTGTGGGGG + Intergenic
1022108343 7:27212797-27212819 GCCCCTCCGAGGTGGGGTGGGGG + Intergenic
1022187854 7:27987342-27987364 TCACCTCCCAGATGGGGTGGCGG - Intronic
1022757127 7:33304381-33304403 TCACCTCCCAGATGGGGTGGCGG - Intronic
1023954111 7:44871429-44871451 TCACCTCCCAGATGGGGTGGTGG + Intergenic
1024006726 7:45229767-45229789 TCTCCCAGGAGGTGGCGTGGTGG - Intergenic
1025203851 7:56980168-56980190 GTCCCTCGCAGTTGGTGTGGGGG - Intergenic
1025668089 7:63596763-63596785 GTCCCTCGCAGTTGGTGTGGGGG + Intergenic
1026023394 7:66727689-66727711 GCCCCTCGCAGGGGTCCTGGCGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1030057265 7:105594298-105594320 TCTCCTGGCAGATGGCGAGGTGG + Intronic
1030060542 7:105617756-105617778 TCCCCTGCCAGGTGGCATGGAGG + Intronic
1038477710 8:27879755-27879777 TGCTCCGGCAGGTGGCGTGGAGG - Exonic
1042926482 8:73972826-73972848 GACCCTCGCGGGTGGAGTGGGGG - Intronic
1044591262 8:93916675-93916697 TCCACTCGCTGGGGGCGGGGGGG + Intronic
1049839124 8:144759364-144759386 TACCCTCTCAGGAGGAGTGGTGG + Intergenic
1052259130 9:26492835-26492857 TCGCCTCCCAGATGGGGTGGTGG - Intergenic
1052796686 9:32929795-32929817 TTCCCTGGAAGGTTGCGTGGTGG - Intergenic
1055297975 9:74853138-74853160 TCACCTCCCAGATGGGGTGGCGG - Intronic
1057974803 9:99593913-99593935 TCCCCTCTGAGGTAGGGTGGAGG + Intergenic
1058777019 9:108294177-108294199 CTCCCTCGCAGCTGGTGTGGGGG - Intergenic
1060504609 9:124188459-124188481 TACACTGGCAGGTGGCCTGGAGG - Intergenic
1061847227 9:133394539-133394561 GCCCCTCGCAGGTGGAGAAGAGG - Intronic
1189421792 X:40862929-40862951 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1191679373 X:63825627-63825649 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1192664046 X:73069437-73069459 TCACCTCCCAGATGGTGTGGTGG - Intergenic
1192892598 X:75407217-75407239 TCACCTCCCAGATGGGGTGGCGG - Intronic
1195119911 X:101739093-101739115 TCACCTCCCAGATGGGGTGGCGG - Intergenic
1198600837 X:138282927-138282949 TCACCTCCCAGATGGGGTGGCGG + Intergenic
1202028754 Y:20551707-20551729 TCACCTCCCAGATGGGGTGGCGG - Intergenic