ID: 1076909526

View in Genome Browser
Species Human (GRCh38)
Location 10:133379988-133380010
Sequence TCCCCTCGCAGGTGGCGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076909517_1076909526 14 Left 1076909517 10:133379951-133379973 CCCTTCTAGGAAAGGGACCTCCA 0: 1
1: 0
2: 2
3: 5
4: 129
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195
1076909522_1076909526 -6 Left 1076909522 10:133379971-133379993 CCAGGTGGCATCTGCTGTCCCCT 0: 1
1: 1
2: 1
3: 41
4: 359
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195
1076909518_1076909526 13 Left 1076909518 10:133379952-133379974 CCTTCTAGGAAAGGGACCTCCAG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195
1076909521_1076909526 -3 Left 1076909521 10:133379968-133379990 CCTCCAGGTGGCATCTGCTGTCC 0: 1
1: 0
2: 2
3: 26
4: 274
Right 1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076909526 Original CRISPR TCCCCTCGCAGGTGGCGTGG TGG Exonic