ID: 1076910277

View in Genome Browser
Species Human (GRCh38)
Location 10:133384461-133384483
Sequence CAGGCTCAGTCTTCAGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076910271_1076910277 13 Left 1076910271 10:133384425-133384447 CCCTCAGGGCCCAGAATGTGTTT No data
Right 1076910277 10:133384461-133384483 CAGGCTCAGTCTTCAGTCAGTGG No data
1076910274_1076910277 3 Left 1076910274 10:133384435-133384457 CCAGAATGTGTTTGTAGACTTGC 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1076910277 10:133384461-133384483 CAGGCTCAGTCTTCAGTCAGTGG No data
1076910272_1076910277 12 Left 1076910272 10:133384426-133384448 CCTCAGGGCCCAGAATGTGTTTG 0: 1
1: 0
2: 1
3: 20
4: 245
Right 1076910277 10:133384461-133384483 CAGGCTCAGTCTTCAGTCAGTGG No data
1076910273_1076910277 4 Left 1076910273 10:133384434-133384456 CCCAGAATGTGTTTGTAGACTTG 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1076910277 10:133384461-133384483 CAGGCTCAGTCTTCAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076910277 Original CRISPR CAGGCTCAGTCTTCAGTCAG TGG Intronic
No off target data available for this crispr