ID: 1076910861

View in Genome Browser
Species Human (GRCh38)
Location 10:133388663-133388685
Sequence GGGGGTCCGAAGGCCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076910861_1076910871 17 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC 0: 1
1: 0
2: 0
3: 34
4: 187
Right 1076910871 10:133388703-133388725 ACTCTGCGAACTGCTGCCTGAGG No data
1076910861_1076910873 29 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC 0: 1
1: 0
2: 0
3: 34
4: 187
Right 1076910873 10:133388715-133388737 GCTGCCTGAGGGACGCTCTGTGG No data
1076910861_1076910874 30 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC 0: 1
1: 0
2: 0
3: 34
4: 187
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910861_1076910872 18 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC 0: 1
1: 0
2: 0
3: 34
4: 187
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076910861 Original CRISPR GGGGGTCCGAAGGCCCTGCC AGG (reversed) Intronic
900292535 1:1929614-1929636 GGTCACCCGAAGGCCCTGCCAGG + Intronic
900396318 1:2454603-2454625 GGGGCTCCAGAGGCCCTGCAGGG - Intronic
900599856 1:3498327-3498349 GGGGGTCTGCAGGCCCTGCTGGG - Intronic
900649135 1:3722496-3722518 GGTAGCCCGTAGGCCCTGCCAGG - Intronic
901403669 1:9031878-9031900 AGGGGTGGGAAGGCCTTGCCGGG + Intergenic
901801980 1:11713553-11713575 GGGGGTCCGTCGGACCTTCCAGG + Intronic
902825911 1:18974150-18974172 GGGGGTCCCAGGGCCATGCCAGG + Intergenic
903472801 1:23598946-23598968 AGGGGACTGGAGGCCCTGCCAGG - Intronic
903540373 1:24093180-24093202 GGGGGTCTGGAGACCCTGGCTGG + Intronic
904745752 1:32709718-32709740 GTGGGTCTGAGGGCCCTGCCAGG - Intergenic
904837651 1:33349622-33349644 GGGGCTGCGTAGGCCCCGCCCGG - Intronic
906098174 1:43238319-43238341 GGAGGTCGGAAAGACCTGCCAGG + Intronic
912771856 1:112471236-112471258 GGTGGTCTGGAGGCCCTGTCAGG - Intronic
912993335 1:114510529-114510551 GGTGAGCCGGAGGCCCTGCCTGG - Exonic
914445793 1:147749616-147749638 GTGGCTCTGAAGGCCCTGCTTGG - Intergenic
916985921 1:170191486-170191508 GGGTGTCTGAAGGCCCTGGATGG + Intergenic
917600641 1:176570642-176570664 GGTGGTCCAAAGGCCCAGCAAGG - Intronic
920032929 1:203048320-203048342 GGGGGCCTGAGGGCCCGGCCTGG - Intronic
923541439 1:234891056-234891078 GTGGGTCTGGAGGCACTGCCTGG - Intergenic
923748638 1:236726368-236726390 GGGGGTACGCAGACTCTGCCAGG - Intronic
924624414 1:245687517-245687539 GGGTGTGAGATGGCCCTGCCCGG + Exonic
1067102415 10:43342868-43342890 GGGGGGCCGGAGGGCCTGGCAGG - Intergenic
1069703082 10:70440532-70440554 GGGGGCCAGACGGCCCTCCCTGG - Intronic
1070877238 10:79825961-79825983 GGGGGTCGGGAGGCACTGCCGGG - Intergenic
1071643735 10:87342005-87342027 GGGGGTCGGGAGGCACTGCCGGG - Intergenic
1073258435 10:102170527-102170549 AGGAGCCCGAAGGCCCTGCCAGG - Intergenic
1073327345 10:102650480-102650502 GGGGGTGTGAAGGTCCTCCCTGG + Intronic
1073578311 10:104642420-104642442 GGGAGTCCGAATGGCCTTCCGGG - Intronic
1075705331 10:124497172-124497194 GAGGGCCCGAGGGCCCGGCCAGG - Intronic
1075723316 10:124599524-124599546 GGGGTTCCGTACTCCCTGCCAGG + Intronic
1076910861 10:133388663-133388685 GGGGGTCCGAAGGCCCTGCCAGG - Intronic
1077077123 11:706861-706883 GGGGCTGCAGAGGCCCTGCCAGG + Intronic
1077126500 11:941065-941087 TGGGGGCCGAGGGGCCTGCCTGG + Intronic
1077815355 11:5681625-5681647 GGGGGTCTGAAGGAACTCCCAGG - Intronic
1081937756 11:46917226-46917248 AGGGGTCTGGAGACCCTGCCTGG - Intronic
1082283634 11:50298132-50298154 GGGGGTCCCCGGGCCCTGGCTGG + Intergenic
1083637012 11:64126228-64126250 GGGGTTCCGAGGACCCTGCCTGG + Intronic
1083744251 11:64726457-64726479 GGCAGTCCGAGGGCCCTGCTGGG - Intergenic
1083781000 11:64917245-64917267 GGGCGTCCGGAGGCGCGGCCTGG - Exonic
1089249049 11:117144461-117144483 GGGGGTCGGAAGGGGCTGCGAGG + Intronic
1089290826 11:117437249-117437271 GTTGGCCCGGAGGCCCTGCCAGG + Exonic
1089489860 11:118876076-118876098 GAGGGACTGAAGGCCCTGCTGGG + Intergenic
1091226071 11:133957012-133957034 GCGGTTCCGGAGGCCCGGCCCGG - Intergenic
1091447672 12:553368-553390 GGGGGCCAGCAGGCCCTCCCGGG - Exonic
1091990905 12:4955194-4955216 GGGAGTCAGCAGGCCCTGACAGG - Intergenic
1092557308 12:9570457-9570479 GGGGGTCCGAAGAGCCTGGAGGG + Intergenic
1094514158 12:31118131-31118153 GGGGGTCCGAAGAGCCTGGGGGG - Intergenic
1094514849 12:31120333-31120355 GGGGGTCCGAAGACCCGGGCGGG - Intergenic
1094514990 12:31120849-31120871 GGGGGTCCGAAGAGCCTGGGGGG - Intergenic
1094515047 12:31121010-31121032 GGGGGTCCGAAGAGCCTGGGGGG - Intergenic
1097280953 12:57845441-57845463 GGGGGCCCGCAGGCCCTCGCGGG - Intronic
1103955169 12:124572270-124572292 GGTGTGCCGAGGGCCCTGCCCGG - Intergenic
1104792582 12:131493270-131493292 GGAGGCCTGAAGGCCGTGCCTGG + Intergenic
1105242615 13:18621274-18621296 GGGGGTGCATAGCCCCTGCCAGG - Intergenic
1105335160 13:19460327-19460349 GAGGGTGCGATGGCCCAGCCGGG - Intronic
1105859755 13:24399059-24399081 GAGGGTGCGATGGCCCAGCCAGG + Intergenic
1106943756 13:34802947-34802969 GGGGATGCGATGGCCTTGCCTGG - Intergenic
1108228756 13:48317301-48317323 AGGGGTCCGAGGGCCCCGCCTGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1112619132 13:101036730-101036752 AGGGGTGTGGAGGCCCTGCCTGG + Intergenic
1112726535 13:102310875-102310897 GGGGGTGGGAAGTCACTGCCAGG + Intronic
1113847026 13:113398043-113398065 GGAGGTCCGAGGCCCCTGCCTGG - Intergenic
1115241012 14:31251100-31251122 GGGGGTGCGATGGCCTGGCCTGG + Intergenic
1116937593 14:50758140-50758162 GCTGCTCCGAAGCCCCTGCCTGG + Exonic
1118321625 14:64756907-64756929 GGAGGCCCCAAAGCCCTGCCTGG + Intronic
1120282222 14:82454084-82454106 GGAGGTACGAAGGCCCTGGCTGG + Intergenic
1122151965 14:99730433-99730455 GTGGGTCCGCAGGCCTCGCCGGG + Intergenic
1122545222 14:102517991-102518013 AGGGGTGCGGAGGCCCTGCCAGG + Intergenic
1122860198 14:104579130-104579152 GGGCGTCCAACTGCCCTGCCTGG - Intronic
1123488683 15:20763333-20763355 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1123545179 15:21332406-21332428 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1126709755 15:51443183-51443205 GGGGTTGTGAAGGCCCAGCCTGG + Intergenic
1127932678 15:63607366-63607388 CGGGGTGGGAAGGCCCTGCCTGG - Intergenic
1128067199 15:64772810-64772832 GGAGGTCGGAAGGACTTGCCAGG - Intronic
1202953525 15_KI270727v1_random:59677-59699 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1132596550 16:753615-753637 AGGAGGCCTAAGGCCCTGCCGGG + Intronic
1132671411 16:1103560-1103582 CAGGTTCCGAAGGCCCAGCCTGG - Intergenic
1132803552 16:1765618-1765640 GGGGTGCCGAGGGCTCTGCCAGG + Intronic
1134143611 16:11742772-11742794 TCGGGCCCGAAGGCCCGGCCCGG + Exonic
1136579129 16:31141557-31141579 GGGGGTCCTGTGGCCCTGGCTGG - Exonic
1136716943 16:32288915-32288937 GGGTGTTCGGAGGCCCCGCCAGG - Intergenic
1136835318 16:33495160-33495182 GGGGGTTCGGAGGCCCCGCCAGG - Intergenic
1137043570 16:35636912-35636934 GGAGGGCCCAAGGCACTGCCAGG - Intergenic
1137686554 16:50390728-50390750 GGGGGCCCGCAGGCCATCCCAGG + Intergenic
1140439342 16:74975009-74975031 GGGGTTCCCCAGGCCATGCCAGG - Intronic
1140808342 16:78553786-78553808 GGGGGTCTGCAGGACCTGCAGGG - Intronic
1141201992 16:81905297-81905319 GGCAGTGCAAAGGCCCTGCCTGG + Intronic
1141667592 16:85473966-85473988 TGGGGGCCGAAGGCCCTGGGGGG + Intergenic
1142440332 16:90094090-90094112 GGGGCTCTGAGGGCCCAGCCCGG + Intergenic
1203009485 16_KI270728v1_random:228872-228894 GGGGGTTCGGAGGCCCCGCCAGG + Intergenic
1203145491 16_KI270728v1_random:1795481-1795503 GGGGGTTCGGAGGCCCCGCCAGG - Intergenic
1145280114 17:21461920-21461942 GGGGGTCTGCAGGCTCAGCCTGG + Intergenic
1145397775 17:22508565-22508587 GGGGGTCTGCAGGCTCAGCCTGG - Intergenic
1145935240 17:28711336-28711358 TGGGGTCCTGAGGCCCTGCTGGG - Intronic
1147425092 17:40342454-40342476 GGGGGTCCGTCGGCTCTCCCAGG - Intronic
1151662310 17:75525490-75525512 GGGGTTCCGCAGGCCCGCCCCGG - Intronic
1151970551 17:77455381-77455403 CGGGGGCAGCAGGCCCTGCCGGG - Intronic
1152465138 17:80462065-80462087 GGAGGTCAGGAGTCCCTGCCAGG - Intergenic
1152629738 17:81405517-81405539 GGGAGTTAGAAGGCCCTGCCAGG - Intronic
1152649312 17:81484571-81484593 AGGGGTCCCAAGGCCCACCCAGG - Intergenic
1153963540 18:10160402-10160424 AGAGGACCGAAGGCCGTGCCAGG - Intergenic
1153972520 18:10239388-10239410 GGCGGCCAGACGGCCCTGCCAGG + Intergenic
1154446325 18:14438603-14438625 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1156595479 18:38543272-38543294 TGGGGTCAGAAGGACCTGGCTGG + Intergenic
1157094313 18:44673417-44673439 AGGGCTCCTAAGGCCCTGCTAGG + Intergenic
1157515978 18:48311727-48311749 GGGGGTCCCAAGGGCATGCATGG + Intronic
1160033350 18:75281057-75281079 GAGGGTCCAGACGCCCTGCCTGG + Intronic
1160256166 18:77250375-77250397 GGGGATCCGGTGGCCGTGCCTGG - Intergenic
1160613589 18:80108121-80108143 GGTGGGCGGAAGGCCCAGCCTGG + Intergenic
1161266179 19:3365891-3365913 GGGGACCCGCAGCCCCTGCCTGG + Intronic
1161297400 19:3526808-3526830 GGGGGTCCGCAGTCCCCGCCAGG + Intronic
1161435151 19:4258582-4258604 GGGGGTCCCAGGCCACTGCCGGG + Intronic
1164017830 19:21268543-21268565 ATGGGTCCCAAGACCCTGCCTGG + Intronic
1165361846 19:35341659-35341681 GGGGGTGCGAAGTCACTACCAGG - Intronic
1165362690 19:35346455-35346477 GGGGGTCCAAAAGCCCAGGCGGG - Intronic
1165384123 19:35500488-35500510 GGGGGACCAAGGGCCCTGCAGGG + Intronic
1165721387 19:38082040-38082062 AGGGGGAGGAAGGCCCTGCCGGG - Exonic
1165903468 19:39179423-39179445 GGGGGGCAGGGGGCCCTGCCCGG + Intronic
1166053882 19:40277349-40277371 TGGTGTCCGAAGGCCTTGGCGGG - Intronic
1167434432 19:49470908-49470930 GAGAGTCCTAAGGCCCTGTCTGG - Exonic
1167694080 19:51003703-51003725 GGGGGGCCGAGGTTCCTGCCAGG - Exonic
926116096 2:10214446-10214468 GGGGGTCCCTGGGCCCTGCATGG + Intergenic
926695531 2:15767833-15767855 GGGGGTCCGAGGGTCAGGCCTGG - Intergenic
927277427 2:21273731-21273753 TGGGGTGCAAAGACCCTGCCAGG + Intergenic
927712170 2:25332749-25332771 GGTGGCCTGAGGGCCCTGCCTGG - Intronic
929913484 2:46114089-46114111 TCGGGTCCAAAGGCCCAGCCTGG - Intronic
932283233 2:70512672-70512694 GGGGTTCCCTAGGCCCTGCTGGG - Intronic
932758608 2:74425376-74425398 GGGAGTCAGAATGCCCTGACGGG - Intronic
934623692 2:95832032-95832054 GGAGGTCTCAAGGTCCTGCCTGG - Intergenic
937223044 2:120353120-120353142 TGGGGTCCCCAGGCCCTTCCTGG - Intergenic
938018244 2:127885573-127885595 GGGGGTCGGGAGGCACTGCCGGG - Intronic
938084457 2:128389661-128389683 GGGGGTCCCCAGGCCCAGCTCGG + Intergenic
938096237 2:128465919-128465941 GAGGGCCTGAAGGCCCTGCCAGG - Intergenic
948183501 2:236001259-236001281 GGAGGCCTGAAGGCCATGCCAGG - Intronic
948823161 2:240560529-240560551 GGGGGACCCAAGCCCCAGCCTGG + Exonic
949000446 2:241610162-241610184 GGGAGTGTGAAGGCCATGCCCGG - Intronic
1168807341 20:679777-679799 GGGGGACAGAAGGCCCTTCCTGG - Intergenic
1170042768 20:12055287-12055309 GGAGATCCTAAGGCCCTGCCTGG + Intergenic
1170578523 20:17681690-17681712 GCCGGCCCGACGGCCCTGCCGGG + Intronic
1173169551 20:40713019-40713041 GGGGGTCCAAAGGCCAGGCTGGG - Intergenic
1175958010 20:62621272-62621294 CGGGGTGCGCAGGACCTGCCAGG - Intergenic
1176024277 20:62977943-62977965 AGGGGTCCTAAGAGCCTGCCTGG + Intergenic
1176738415 21:10574659-10574681 GAGGGTGCGATGGCCCAGCCGGG + Intronic
1179540016 21:42078141-42078163 TGGGGTCAGCTGGCCCTGCCTGG - Intronic
1179540159 21:42078741-42078763 TGGGGTCAGCTGGCCCTGCCTGG - Intronic
1180763104 22:18223700-18223722 AGGGGTCCGAGGGCCCCGCCCGG + Intergenic
1180772541 22:18400847-18400869 AGGGGTCCGAGGGCCCCGCCCGG - Intergenic
1180803921 22:18650463-18650485 AGGGGTCCGAGGGCCCCGCCCGG - Intergenic
1180806842 22:18718986-18719008 AGGGGTCCGAGGGCCCCGCCCGG + Intergenic
1180985833 22:19903530-19903552 GCGGGGCCCAAGTCCCTGCCGGG + Intronic
1181217797 22:21344796-21344818 AGGGGTCCGAGGGCCCCACCCGG + Intergenic
1182952419 22:34390242-34390264 AGGTGTCTGAAGGCCCTGCTGGG + Intergenic
1183098817 22:35570863-35570885 GGTGGTGCCAAGGCCCTGACAGG - Intergenic
1183835950 22:40453377-40453399 GGGAGTCCGAGGGCACTGACCGG + Intronic
1203234379 22_KI270731v1_random:141835-141857 AGGGGTCCGAGGGCCCCGCCCGG - Intergenic
950702189 3:14758234-14758256 GGGGGTCCGGAGGGCCATCCAGG + Intronic
951922306 3:27869957-27869979 TGGGGTCCAAAGGTACTGCCTGG + Intergenic
953398453 3:42591141-42591163 GGGGGACCGAACCCCATGCCGGG - Intronic
953559154 3:43971471-43971493 GTGGGTGAGGAGGCCCTGCCTGG - Intergenic
954369471 3:50162655-50162677 GGAGGTGTGAGGGCCCTGCCAGG + Intronic
954661401 3:52228803-52228825 GGGTGTCCGGGGACCCTGCCTGG - Exonic
955382615 3:58452147-58452169 GGGGGTCATAAGGACCTGCAAGG - Intergenic
961710585 3:128824992-128825014 GGAGGTGCGGTGGCCCTGCCTGG - Intergenic
969240199 4:5892504-5892526 GGGCGCCCGAGGGCCATGCCCGG - Intronic
969637857 4:8379656-8379678 GGGGGTGCTAAGGACCTACCGGG + Intronic
969677217 4:8620798-8620820 GGGGGGCCGATGGCACAGCCAGG - Intergenic
969679125 4:8632074-8632096 GGGGGGCCGATGGCACAGCCAGG - Intergenic
975689319 4:76949289-76949311 GGTGGTCCGCAGCCCCTTCCAGG + Intergenic
979335307 4:119455159-119455181 GGGGGTCCCCGGGCCCTGCCTGG - Intergenic
985441500 4:189984782-189984804 GGGGCTCTGAGGGCCCAGCCCGG - Intergenic
985490060 5:174108-174130 TGGGGGCCGCAGGGCCTGCCAGG + Intronic
985623233 5:967210-967232 GAGGGTCCCAAGGGCCCGCCTGG - Intergenic
993901719 5:93588506-93588528 GAGGCTCCGAAGGCCAGGCCCGG - Intronic
997525263 5:134548938-134548960 GGGGTTCAGAAAGCACTGCCAGG + Intronic
998159774 5:139806846-139806868 GGGGGCCCAGAGTCCCTGCCTGG - Intronic
998442980 5:142177610-142177632 ATGGGTCCGAGGGCCTTGCCTGG + Intergenic
999255825 5:150209627-150209649 GGCGGGCAGAAGGCCCTGCCCGG + Exonic
1001496091 5:172188408-172188430 GGGGGTCCCGGGGCTCTGCCGGG - Intergenic
1001628721 5:173158618-173158640 TGGGCTCTGAAGGCCGTGCCTGG + Intronic
1002335895 5:178478114-178478136 GGGGGCCCGCAGGCACTGTCTGG - Intronic
1002422930 5:179158990-179159012 GGTGGTACAAAGGCCCTGCCCGG + Intronic
1002934689 6:1661654-1661676 GGCTGTCCGAGGACCCTGCCCGG + Intronic
1006518075 6:34555671-34555693 GGGGGACCCCAGGCCTTGCCGGG + Intronic
1007248520 6:40479786-40479808 GGGGGTTTGAAGACCATGCCAGG + Intronic
1011418991 6:87152342-87152364 GGGGGTAGGAAGGACCTGCCAGG + Intergenic
1013421694 6:109972841-109972863 GGGGGCCTGATGGCCATGCCAGG + Intergenic
1013663741 6:112325723-112325745 AGTGGTCGGAAGGCCCTGGCTGG + Intergenic
1017146731 6:151241100-151241122 GGAGCTCCGGAGGCCCGGCCCGG - Intronic
1018937341 6:168282415-168282437 GAGGGTCAGAAAGCCTTGCCTGG + Intergenic
1019045201 6:169140118-169140140 GGGGCTCCGGAGGCCCGGGCCGG - Intergenic
1019519101 7:1452650-1452672 GGGGGTGAGATGGCCCTGCAGGG - Intronic
1019538705 7:1541842-1541864 GGGGTTGCGGAGCCCCTGCCTGG + Exonic
1022191635 7:28021662-28021684 GCTGGTCAGGAGGCCCTGCCTGG - Intronic
1024117805 7:46209753-46209775 GGGGGTCCTGAGGCCTGGCCTGG - Intergenic
1025237607 7:57245328-57245350 GGGTGTCAGGAGGCCCAGCCTGG - Intergenic
1025561902 7:62380349-62380371 GGGGGGCAAAAAGCCCTGCCGGG - Intergenic
1028339108 7:89695600-89695622 GTGGTTCCGAAGGCCCTGGGTGG - Intergenic
1029125726 7:98293992-98294014 TGGGCACCGAAGGCCCTTCCGGG + Intronic
1029440057 7:100582504-100582526 GGGGGACTGAAGGTCCTGTCCGG - Intronic
1034329332 7:150269288-150269310 AGGGCTCCGAACGCCCTGTCAGG - Intronic
1034668722 7:152840572-152840594 AGGGCTCCGAACGCCCTGTCAGG + Intronic
1036506348 8:9359987-9360009 GGGAGGCCGAAGGCAGTGCCAGG - Intergenic
1047777920 8:128088924-128088946 GTGGGTGAGAAGGCACTGCCAGG + Intergenic
1049513902 8:143043571-143043593 GGGGGTCCCAAGGCCGGGGCAGG - Intronic
1049573104 8:143378688-143378710 GGGGGTCCGCATGGCCTGCAGGG - Exonic
1049643050 8:143724008-143724030 GAGGCTCCGAAGGCCCAGGCAGG + Exonic
1056044394 9:82701964-82701986 GGGGATGCGAAGGCCTGGCCTGG + Intergenic
1056942363 9:90966483-90966505 GAGGGTCCCGAGGCCCAGCCAGG + Intergenic
1057273759 9:93665451-93665473 TGGGGACTGAAGGCCCAGCCTGG + Intronic
1058608826 9:106753008-106753030 GGGGGCCATAAGACCCTGCCTGG + Intergenic
1061190947 9:129082286-129082308 GGGGGTGGTATGGCCCTGCCAGG + Intronic
1061416864 9:130451769-130451791 GAGGCTCCCAGGGCCCTGCCTGG + Exonic
1061700231 9:132410181-132410203 GGAGCTCCGAAGGGCCTGCCGGG - Intronic
1061941381 9:133886042-133886064 GGGGGCGGGAAGGCCCAGCCGGG + Intronic
1062232167 9:135487692-135487714 AGGGGTCCGAGGGCCCCGCCCGG + Exonic
1062468642 9:136692461-136692483 TGGGCTCCGACGGCCCTTCCTGG - Intergenic
1062566723 9:137166968-137166990 CTGGGTCCCAGGGCCCTGCCTGG + Intronic
1188442198 X:30223558-30223580 GGGGATCCCCAGGCCCTGCCAGG + Intergenic
1192166314 X:68829547-68829569 CGGGGGCCGAAGCCCATGCCCGG + Exonic
1198313124 X:135438886-135438908 TGGGGTCCGCAGGCGATGCCGGG - Intergenic
1199643339 X:149883237-149883259 CGGGGGTCCAAGGCCCTGCCAGG + Exonic
1200164367 X:154026026-154026048 GTGGGTCTGGAGGACCTGCCCGG - Intronic