ID: 1076910861

View in Genome Browser
Species Human (GRCh38)
Location 10:133388663-133388685
Sequence GGGGGTCCGAAGGCCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076910861_1076910872 18 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910861_1076910871 17 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC No data
Right 1076910871 10:133388703-133388725 ACTCTGCGAACTGCTGCCTGAGG No data
1076910861_1076910873 29 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC No data
Right 1076910873 10:133388715-133388737 GCTGCCTGAGGGACGCTCTGTGG No data
1076910861_1076910874 30 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076910861 Original CRISPR GGGGGTCCGAAGGCCCTGCC AGG (reversed) Intronic