ID: 1076910872

View in Genome Browser
Species Human (GRCh38)
Location 10:133388704-133388726
Sequence CTCTGCGAACTGCTGCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076910858_1076910872 29 Left 1076910858 10:133388652-133388674 CCTTGAGGGTCCCTGGCAGGGCC No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910863_1076910872 8 Left 1076910863 10:133388673-133388695 CCTTCGGACCCCCAGGACTTTGC No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910866_1076910872 -2 Left 1076910866 10:133388683-133388705 CCCAGGACTTTGCCGCCCACACT No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910867_1076910872 -3 Left 1076910867 10:133388684-133388706 CCAGGACTTTGCCGCCCACACTC No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910861_1076910872 18 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910864_1076910872 0 Left 1076910864 10:133388681-133388703 CCCCCAGGACTTTGCCGCCCACA No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910865_1076910872 -1 Left 1076910865 10:133388682-133388704 CCCCAGGACTTTGCCGCCCACAC No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data
1076910860_1076910872 19 Left 1076910860 10:133388662-133388684 CCCTGGCAGGGCCTTCGGACCCC No data
Right 1076910872 10:133388704-133388726 CTCTGCGAACTGCTGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076910872 Original CRISPR CTCTGCGAACTGCTGCCTGA GGG Intronic