ID: 1076910874

View in Genome Browser
Species Human (GRCh38)
Location 10:133388716-133388738
Sequence CTGCCTGAGGGACGCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076910864_1076910874 12 Left 1076910864 10:133388681-133388703 CCCCCAGGACTTTGCCGCCCACA No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910865_1076910874 11 Left 1076910865 10:133388682-133388704 CCCCAGGACTTTGCCGCCCACAC No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910861_1076910874 30 Left 1076910861 10:133388663-133388685 CCTGGCAGGGCCTTCGGACCCCC No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910870_1076910874 -6 Left 1076910870 10:133388699-133388721 CCACACTCTGCGAACTGCTGCCT No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910863_1076910874 20 Left 1076910863 10:133388673-133388695 CCTTCGGACCCCCAGGACTTTGC No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910869_1076910874 -5 Left 1076910869 10:133388698-133388720 CCCACACTCTGCGAACTGCTGCC No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910867_1076910874 9 Left 1076910867 10:133388684-133388706 CCAGGACTTTGCCGCCCACACTC No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910868_1076910874 -2 Left 1076910868 10:133388695-133388717 CCGCCCACACTCTGCGAACTGCT No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data
1076910866_1076910874 10 Left 1076910866 10:133388683-133388705 CCCAGGACTTTGCCGCCCACACT No data
Right 1076910874 10:133388716-133388738 CTGCCTGAGGGACGCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076910874 Original CRISPR CTGCCTGAGGGACGCTCTGT GGG Intronic