ID: 1076910884

View in Genome Browser
Species Human (GRCh38)
Location 10:133388762-133388784
Sequence AAGGAACCACTGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076910884_1076910894 23 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910894 10:133388808-133388830 TGGGCTGGACACTGTCATCCCGG 0: 1
1: 0
2: 0
3: 21
4: 207
1076910884_1076910893 8 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910893 10:133388793-133388815 ACGCGGGCGGAGAGCTGGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 219
1076910884_1076910892 4 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910892 10:133388789-133388811 AGAAACGCGGGCGGAGAGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1076910884_1076910891 3 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910891 10:133388788-133388810 GAGAAACGCGGGCGGAGAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 140
1076910884_1076910887 -9 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910887 10:133388776-133388798 TGGTTCCTTGCTGAGAAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 111
1076910884_1076910895 24 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910895 10:133388809-133388831 GGGCTGGACACTGTCATCCCGGG 0: 1
1: 1
2: 5
3: 20
4: 194
1076910884_1076910888 -8 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910888 10:133388777-133388799 GGTTCCTTGCTGAGAAACGCGGG 0: 1
1: 0
2: 0
3: 4
4: 104
1076910884_1076910896 25 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910896 10:133388810-133388832 GGCTGGACACTGTCATCCCGGGG 0: 1
1: 0
2: 1
3: 13
4: 100
1076910884_1076910889 -5 Left 1076910884 10:133388762-133388784 CCCTGCTCCATCAGTGGTTCCTT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 1076910889 10:133388780-133388802 TCCTTGCTGAGAAACGCGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076910884 Original CRISPR AAGGAACCACTGATGGAGCA GGG (reversed) Intronic
901426586 1:9185533-9185555 AGGGAACCACAGAGGTAGCACGG + Intergenic
903426208 1:23256292-23256314 GAGGAAACAGTGATGGAGAAAGG + Intergenic
903570547 1:24301293-24301315 AACAAAACAGTGATGGAGCAGGG - Intergenic
904969082 1:34404987-34405009 CAGGACCCACTGCTGGAGCTGGG + Intergenic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
905481100 1:38262554-38262576 AAGGAAGCACTCATGGGGCTTGG + Intergenic
908020620 1:59894367-59894389 GAAGAACCACTGAAGGAGGAAGG - Intronic
908632242 1:66122025-66122047 AAGGAAGCAGTGAGGGAGAAAGG - Intronic
910235142 1:85027713-85027735 AAGGCCTCACTGAGGGAGCAGGG + Intronic
915734156 1:158074217-158074239 GAGGAGCCACTCATGGAGTATGG + Intronic
916660325 1:166917496-166917518 AAGAAACCACTGCTGGATTAAGG + Exonic
917255551 1:173112133-173112155 AAGGAACCACTGCAAGAACATGG - Intergenic
918763880 1:188453174-188453196 AAGAGACCAGTGATGGAACAAGG + Intergenic
920679910 1:208064470-208064492 AAGGAACCACCGATAGGGCAGGG - Intronic
1063657156 10:8002533-8002555 GAGGAACTACTGATAGAGCAGGG + Intronic
1063974502 10:11404719-11404741 CAGGAGCCTGTGATGGAGCAGGG - Intergenic
1064003899 10:11685096-11685118 GAGGAGCCCCTGATGGAGCCGGG - Intergenic
1065077734 10:22097996-22098018 AAGGAAACACTACTGGATCATGG - Intergenic
1067115464 10:43432468-43432490 AAAGAACCACAGATGTAGCCAGG - Intergenic
1067141857 10:43664646-43664668 TAGGCACCACTAATGGGGCAGGG - Intergenic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1069837671 10:71319430-71319452 AAGGGACCACGGATGGGGTAGGG - Intronic
1072293795 10:93991099-93991121 AAGGAAGGACTGAAGGAACAAGG - Intergenic
1072345842 10:94505256-94505278 ATGAAATCACTGATGGAGCCAGG + Intronic
1072985422 10:100135410-100135432 AAGGAAGCTCTGATTGATCAGGG - Intergenic
1074446332 10:113524223-113524245 AAGAACACACTGATGGACCATGG - Intergenic
1075406012 10:122196101-122196123 AAGGAACCAAGGATGGGGCTGGG + Intronic
1076823134 10:132951903-132951925 AAGGAAGCAGTGAAGGAGCAGGG - Intergenic
1076910884 10:133388762-133388784 AAGGAACCACTGATGGAGCAGGG - Intronic
1077247069 11:1544827-1544849 CAGGAAGCAGTGAAGGAGCAGGG + Intergenic
1078271400 11:9798361-9798383 AAGGAGCCAGTGATGGAGAGGGG + Intronic
1078285563 11:9951127-9951149 AAGGAAAGATTGAGGGAGCAGGG + Intronic
1084935447 11:72584333-72584355 AAGGAACCACCGGTGGAGGGAGG + Intronic
1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG + Intergenic
1091474405 12:757740-757762 AAGAAAACATTGATGGAGCCGGG + Intronic
1092032306 12:5297410-5297432 AAGGAACCACTGAATGAATAAGG + Intergenic
1092732894 12:11551002-11551024 AAGGAACCAGGGCTGGGGCAGGG + Intergenic
1093158371 12:15715309-15715331 AAGGAAACACTGTTGGGCCAAGG - Intronic
1094090664 12:26645441-26645463 AAGGAACCACATATGGAAGATGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1097640804 12:62178962-62178984 AAGGAAACTCTGATAGAGAAAGG - Intronic
1099565044 12:84231504-84231526 AAGCCACCACTGATGGGGCATGG + Intergenic
1104698706 12:130884510-130884532 AAGCAACTCCTGATGGATCAAGG - Intergenic
1104893504 12:132151220-132151242 AAGGAGCAGCGGATGGAGCAGGG - Intronic
1107073673 13:36298393-36298415 AAGGAAACACAGATGTATCAAGG - Intergenic
1107351665 13:39520946-39520968 AAGGGACTACTGATGGGTCATGG + Intronic
1109861933 13:68211482-68211504 AAGGAACAAAAGATGGAGAATGG + Intergenic
1110619405 13:77578344-77578366 AAGGAACTCCTGGGGGAGCAGGG + Intronic
1111904282 13:94237565-94237587 AAGGAGCCACTCATTGAACAAGG + Intronic
1114176362 14:20323963-20323985 AAGGATCAACTGATCCAGCAAGG + Intronic
1120625926 14:86826432-86826454 AAGGAAAAACTGATGGTGCAGGG + Intergenic
1125881210 15:43197685-43197707 AAGGAACAACAGATGTAGCTTGG - Intronic
1126103363 15:45133093-45133115 ATGGAATCAGGGATGGAGCAGGG - Intronic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1127183797 15:56455830-56455852 AAGAAACAACTGAAGGAACAAGG + Intronic
1127296832 15:57616030-57616052 AAGGAACCATGGATGGGGTAGGG - Intronic
1127623472 15:60757255-60757277 AAGGAAAGACTGATGATGCAAGG - Intronic
1127880683 15:63155681-63155703 AAAGAACCACTGTCTGAGCATGG + Exonic
1128274767 15:66344003-66344025 AAAGAACCACTTATGAAACATGG + Intronic
1128281839 15:66401682-66401704 AAGCAAGCACTGTTGGAGCTTGG + Intronic
1128534904 15:68482864-68482886 AAGGAACCAATGATGGAGGCAGG + Intergenic
1129603560 15:77013897-77013919 ATGGAACCTCTGGTGGAGGAAGG + Intronic
1130691412 15:86084730-86084752 AAGGAACTCCTGATGAAGGAAGG + Intergenic
1132882137 16:2167173-2167195 AAGGTACCCATGATGGGGCAGGG + Intronic
1135888248 16:26333267-26333289 ATGGAACAACTTATGGAGTATGG + Intergenic
1138662760 16:58533832-58533854 AAGAAACCACTGATGTGGCCAGG + Intronic
1139312408 16:66038827-66038849 GAGGAACTACTGCTGGGGCAAGG - Intergenic
1139918669 16:70444754-70444776 AAAGAACCACTGTCTGAGCATGG + Intergenic
1140058830 16:71549600-71549622 AAGGCTCCACTTGTGGAGCAAGG + Intronic
1140141288 16:72260448-72260470 ATGGAATAACTGATGGAACAGGG + Intergenic
1140735523 16:77894571-77894593 GAGGAACTGCTGATGGGGCATGG + Intronic
1141859544 16:86706993-86707015 CAGGAACCACTGTAGGAGCTGGG + Intergenic
1142210409 16:88805848-88805870 ATCGAGCCACTGCTGGAGCAGGG + Exonic
1143754545 17:9056840-9056862 AAGGAAGAACTGATGGGGCGTGG + Intronic
1144520568 17:15949945-15949967 AAGGTAACACTGATGCAGAAGGG - Intronic
1146453713 17:32993857-32993879 GAGGGACAACGGATGGAGCAAGG + Intronic
1146486320 17:33245846-33245868 GAGGAAGCACTAATGGAGGAAGG + Intronic
1147979108 17:44263733-44263755 AAGGAAGCAGGGATGGAGGAAGG - Intronic
1148757919 17:49984262-49984284 CAGGAACCACTGATGGTGAGTGG - Intergenic
1150135063 17:62690918-62690940 AAGAAGGCACTGAGGGAGCAGGG - Intronic
1152263840 17:79282004-79282026 AAGAAAACACTGAGGGGGCAGGG + Intronic
1152659156 17:81534504-81534526 CAGGAACCCCAGATGGAGCCCGG + Intronic
1153686123 18:7547342-7547364 AAGGAAGCACTGAAAGAACAAGG + Intergenic
1156173133 18:34510480-34510502 ATGGAATGACTGATGGAACAGGG - Intronic
1158756263 18:60329384-60329406 AAGGAAGCACTGGTGGAGAAAGG - Intergenic
1160406134 18:78647433-78647455 CGGGGACCACAGATGGAGCAGGG - Intergenic
1163627940 19:18401617-18401639 AAGGAACCCCTTAGGGAGTAAGG + Intergenic
1167035061 19:46990286-46990308 CAGGAACAACTGATGAGGCAAGG - Intronic
927203482 2:20592659-20592681 AAGGACCCTCTGAGGGCGCAGGG - Intronic
927848380 2:26483744-26483766 AAGGGACAGCTGAGGGAGCAAGG + Intronic
929019504 2:37537680-37537702 AAGATAGCACTGGTGGAGCATGG + Intergenic
932261804 2:70333178-70333200 AAGGAAGCATTGCTGGAACAGGG - Intergenic
932921726 2:75923381-75923403 AAGCAAGAACTCATGGAGCAAGG - Intergenic
933073480 2:77891997-77892019 AGGGAACCTGAGATGGAGCAGGG - Intergenic
946748648 2:222870965-222870987 AAGGATGCATTGATGGAGGAGGG + Intronic
946767826 2:223056419-223056441 AAGTACCAACTGATGGATCAGGG - Intronic
947376513 2:229502157-229502179 AAGGAAACCCATATGGAGCATGG + Intronic
948732865 2:239978138-239978160 ATGGGACCGTTGATGGAGCAGGG - Intronic
949058399 2:241942335-241942357 ATGGGACCCCTGATGGAGAACGG + Intergenic
1169404382 20:5311346-5311368 ATGGAACTGCTGATGGAGCTGGG + Intronic
1170535524 20:17337153-17337175 AGGAAACCAATGATGGAGGATGG + Intronic
1170788951 20:19491893-19491915 AACTAATCACTGATGGAGGAAGG - Intronic
1174475431 20:50792816-50792838 AAGTAACCACTTTTGGAACATGG + Intergenic
1182373773 22:29830967-29830989 ATGGAAACACTGATGGAGACTGG - Intronic
1182408092 22:30155572-30155594 AAGGAACCACTGAAAAACCAGGG - Intronic
1182424666 22:30265817-30265839 AAGGAGCCACTTATGGAGAGAGG - Intronic
1182508174 22:30800368-30800390 AAGGAAGCACTGGTGGAACCTGG + Intronic
1184874242 22:47263069-47263091 AGGGCACCAGTGATGAAGCACGG - Intergenic
1184940825 22:47763587-47763609 AAGGAGCAACTCATCGAGCAGGG - Intergenic
949809174 3:7987654-7987676 CAGGAACCAGGGATGGGGCAAGG + Intergenic
950567726 3:13780921-13780943 AAGGAGCCAGGGAGGGAGCAGGG + Intergenic
951189468 3:19751535-19751557 ATGTAACTACTGATGTAGCATGG + Intergenic
951463529 3:22977130-22977152 AGGGAACCACTGCAGGTGCAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
954608525 3:51932009-51932031 AAGGAAGCCCCGACGGAGCAAGG + Intergenic
954794030 3:53152379-53152401 ATGGACTGACTGATGGAGCAAGG - Intergenic
955548768 3:60059965-60059987 AAACAACAACTCATGGAGCACGG - Intronic
955729442 3:61969154-61969176 AATGAACCACTCATTGAGCCAGG - Intronic
955755856 3:62224347-62224369 GAGAAACCACTGGTGGAGGAGGG - Intronic
956159102 3:66329760-66329782 GAGGTAACAGTGATGGAGCAAGG - Intronic
962247976 3:133813813-133813835 TATGAACCGCTTATGGAGCAAGG - Intronic
966851225 3:184166329-184166351 AAGGGGCCTCTGAAGGAGCAGGG - Intronic
968963738 4:3759001-3759023 AAGGACCCACAGATGGAGACAGG + Intergenic
969648910 4:8451537-8451559 CAGCAGCCACTGATGGACCAGGG + Intronic
969944957 4:10773938-10773960 AAGCATCCACTGATGTTGCAAGG + Intergenic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
975657470 4:76656039-76656061 AAGGAATCTCTGATACAGCAGGG - Intronic
977300097 4:95257567-95257589 AAGGACCCATTTACGGAGCAGGG + Intronic
979522106 4:121679440-121679462 AAGGAACAATTGAGGGAGGAAGG - Intronic
983325797 4:166255382-166255404 AAAGAACAACTGAAAGAGCAAGG + Intergenic
986264997 5:6183617-6183639 AAGGAACCACTGTAGAAGCAAGG + Intergenic
987011976 5:13776053-13776075 AAGGAAGCACTAATGGTCCATGG + Intronic
989992902 5:50789258-50789280 AAGAAAACACTGATAGAGCCAGG + Intronic
991252799 5:64582458-64582480 AGGGGACCACTGACAGAGCAAGG - Intronic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
993604360 5:89970085-89970107 AAGGAATCAAAGATGGAGAATGG + Intergenic
994608346 5:102000749-102000771 AACAAACCACTGTTGCAGCATGG - Intergenic
994608492 5:102004021-102004043 AACAAACCACTGTTGCAGCATGG - Intergenic
996432116 5:123392798-123392820 AAGCAAACATTGGTGGAGCATGG - Intronic
997309957 5:132871682-132871704 AAGGAACCACTGTTGGGGAAGGG - Intergenic
1001551649 5:172606843-172606865 AAGGAACAAATGATAGAGCTGGG + Intergenic
1002169901 5:177369158-177369180 AGAGAACCACTGTTGGAGCTGGG + Intronic
1005276713 6:24227404-24227426 AACAAACCACTGAAGAAGCAGGG + Intronic
1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG + Intergenic
1008290232 6:49705953-49705975 CAAGAACCACTGCAGGAGCATGG - Intronic
1010571701 6:77481038-77481060 AAGGAAAGAGGGATGGAGCATGG + Intergenic
1011186092 6:84677020-84677042 AAGGAAGGAGTGAGGGAGCAGGG + Intergenic
1014772086 6:125468319-125468341 AAGGAGCCAGTTCTGGAGCAAGG + Intergenic
1018757966 6:166865908-166865930 AAGGAAAGACGGATGGAGAAGGG + Intronic
1022092802 7:27118443-27118465 AGGGAACCACTGAAGGAACTAGG + Intronic
1027737016 7:81945354-81945376 AAAGAAGAACTGATGAAGCAAGG + Intergenic
1028470239 7:91197939-91197961 AACGAACAACTGATCGACCAAGG - Intronic
1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG + Intergenic
1030361972 7:108604899-108604921 AAGGAACCAATGAGAAAGCAGGG - Intergenic
1030578750 7:111324463-111324485 AAGGAACCTCTGATGAATTATGG - Intronic
1031405149 7:121376364-121376386 GAGGAATCACTGATGAAGAAGGG + Intronic
1031660932 7:124423143-124423165 AAGGAAGCACTGATGAGGCCAGG - Intergenic
1032282681 7:130517188-130517210 AAGGAACCATTCTTGGATCAAGG + Intronic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1037808025 8:22069251-22069273 AAGGACCTACTGATGGTGCCTGG - Intronic
1039057186 8:33546260-33546282 AAGGAAGCACTGAGTCAGCAGGG - Intergenic
1041007395 8:53508435-53508457 AGGGAACCATTGCTGGGGCAGGG - Intergenic
1041178888 8:55227349-55227371 AAAGAACCACTGAGGGACCAAGG + Intronic
1041389213 8:57334149-57334171 AAGGAAGCACAGACGGAGAATGG - Intergenic
1042600498 8:70494714-70494736 GAAAAATCACTGATGGAGCATGG - Intergenic
1042776580 8:72438902-72438924 AAGGCACAACTGCTGGAGAAAGG + Intergenic
1043267965 8:78290077-78290099 AAGGAACAACTCAAAGAGCAAGG + Intergenic
1043594048 8:81863823-81863845 TGGGAAGCTCTGATGGAGCATGG + Intergenic
1044586078 8:93870221-93870243 AAGAAACCAATGCTGGGGCAGGG + Intronic
1045494790 8:102699274-102699296 GAGGAAGCACTGAGGGAGCCTGG + Intergenic
1047974708 8:130118493-130118515 ATGGAACCACTGCTGGAACCTGG - Exonic
1048326599 8:133443845-133443867 AATGAGGCCCTGATGGAGCAAGG - Intergenic
1052741123 9:32394047-32394069 AAGAAACAAGGGATGGAGCAAGG - Intronic
1052829938 9:33206976-33206998 AAGGAGCCAGTGCTGGGGCAGGG - Intergenic
1056542012 9:87579896-87579918 AAGTAACCACTTGTGGATCAAGG + Intronic
1059029743 9:110678347-110678369 AAGGATCCACTGAAGGATCCAGG - Intronic
1060104945 9:120867851-120867873 AAGGAACCACAGATGTAAGAGGG - Intronic
1060119891 9:120979088-120979110 AAGGAAAAAGTGAGGGAGCAAGG - Intronic
1060273350 9:122163743-122163765 GAGGAACCACTGATAGATCCTGG + Intronic
1060458802 9:123827834-123827856 AAGGAAGGAAGGATGGAGCAAGG + Intronic
1061404370 9:130385368-130385390 AAGGACCCACTGAGTGACCAGGG - Intronic
1185815592 X:3152190-3152212 ATGGAACCACTGATGGAATTTGG - Intergenic
1186946918 X:14578919-14578941 TAGGATCCACTGCTGTAGCATGG - Intronic
1196069628 X:111506379-111506401 AAGGGACCATTGATGGATGAAGG - Intergenic
1198394960 X:136211640-136211662 AGGGAATCCCTGATGAAGCATGG + Intergenic