ID: 1076912425

View in Genome Browser
Species Human (GRCh38)
Location 10:133397964-133397986
Sequence GAGGTAGACTTGCCCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076912421_1076912425 2 Left 1076912421 10:133397939-133397961 CCAGTGCTTCTGAAGAATCGGGA 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1076912425 10:133397964-133397986 GAGGTAGACTTGCCCCTGGGTGG No data
1076912418_1076912425 18 Left 1076912418 10:133397923-133397945 CCTGGTCAGAGAAAGGCCAGTGC 0: 1
1: 0
2: 2
3: 17
4: 233
Right 1076912425 10:133397964-133397986 GAGGTAGACTTGCCCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076912425 Original CRISPR GAGGTAGACTTGCCCCTGGG TGG Intronic
No off target data available for this crispr