ID: 1076916879

View in Genome Browser
Species Human (GRCh38)
Location 10:133427394-133427416
Sequence CCAAGGGTGGCTCCTGCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076916870_1076916879 8 Left 1076916870 10:133427363-133427385 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG No data
1076916872_1076916879 7 Left 1076916872 10:133427364-133427386 CCTTTTTCCTGCTGGGAGTGGGA No data
Right 1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG No data
1076916868_1076916879 9 Left 1076916868 10:133427362-133427384 CCCCTTTTTCCTGCTGGGAGTGG No data
Right 1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG No data
1076916864_1076916879 15 Left 1076916864 10:133427356-133427378 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG No data
1076916867_1076916879 10 Left 1076916867 10:133427361-133427383 CCCCCTTTTTCCTGCTGGGAGTG No data
Right 1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG No data
1076916874_1076916879 0 Left 1076916874 10:133427371-133427393 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG No data
1076916863_1076916879 30 Left 1076916863 10:133427341-133427363 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076916879 10:133427394-133427416 CCAAGGGTGGCTCCTGCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076916879 Original CRISPR CCAAGGGTGGCTCCTGCCAT CGG Intergenic
No off target data available for this crispr