ID: 1076917743

View in Genome Browser
Species Human (GRCh38)
Location 10:133432961-133432983
Sequence CCTCCCTCACCGGCGCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076917730_1076917743 1 Left 1076917730 10:133432937-133432959 CCCTTGACCCAGCCTTCTACCAC No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data
1076917731_1076917743 0 Left 1076917731 10:133432938-133432960 CCTTGACCCAGCCTTCTACCACC No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data
1076917732_1076917743 -6 Left 1076917732 10:133432944-133432966 CCCAGCCTTCTACCACCCCTCCC No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data
1076917733_1076917743 -7 Left 1076917733 10:133432945-133432967 CCAGCCTTCTACCACCCCTCCCT No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data
1076917724_1076917743 30 Left 1076917724 10:133432908-133432930 CCCCGTGGACAAGTGGAATTCCT No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data
1076917729_1076917743 10 Left 1076917729 10:133432928-133432950 CCTGGGTGACCCTTGACCCAGCC No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data
1076917725_1076917743 29 Left 1076917725 10:133432909-133432931 CCCGTGGACAAGTGGAATTCCTG No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data
1076917726_1076917743 28 Left 1076917726 10:133432910-133432932 CCGTGGACAAGTGGAATTCCTGG No data
Right 1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076917743 Original CRISPR CCTCCCTCACCGGCGCTCGG GGG Intergenic
No off target data available for this crispr