ID: 1076922243

View in Genome Browser
Species Human (GRCh38)
Location 10:133460027-133460049
Sequence CACACTTCGGAGCCGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076922231_1076922243 3 Left 1076922231 10:133460001-133460023 CCGCGCCCTGAGCGCCCTGGGGG 0: 1
1: 0
2: 1
3: 19
4: 258
Right 1076922243 10:133460027-133460049 CACACTTCGGAGCCGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 78
1076922233_1076922243 -2 Left 1076922233 10:133460006-133460028 CCCTGAGCGCCCTGGGGGCCGCA 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1076922243 10:133460027-133460049 CACACTTCGGAGCCGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 78
1076922234_1076922243 -3 Left 1076922234 10:133460007-133460029 CCTGAGCGCCCTGGGGGCCGCAC 0: 1
1: 0
2: 1
3: 17
4: 163
Right 1076922243 10:133460027-133460049 CACACTTCGGAGCCGGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076922243 Original CRISPR CACACTTCGGAGCCGGGGCA GGG Intergenic
900566705 1:3335861-3335883 CACACTTCAGTGCAGGAGCATGG - Intronic
901012187 1:6208198-6208220 CACACTTGGGGGCGGGGGGAGGG - Intronic
903445980 1:23423553-23423575 GACACTTAGGAGCCTGGGAAAGG - Intronic
903928532 1:26848980-26849002 CACACCTCAGAGCTGGGGGAAGG - Intronic
904376302 1:30084561-30084583 CACACTGGGAAGTCGGGGCAGGG - Intergenic
904495445 1:30884045-30884067 CACAATTGGGAGCCGGGACCAGG + Intronic
905626135 1:39491600-39491622 CAGACGGCTGAGCCGGGGCAAGG + Intergenic
905633010 1:39529441-39529463 CTCACTACGGGGCCAGGGCAGGG - Intergenic
911178813 1:94843202-94843224 CAGATTTCAGGGCCGGGGCAAGG + Intronic
917120117 1:171638341-171638363 CACACTTGGGAGGCTGGGCTGGG - Intronic
919753735 1:201053829-201053851 CACACTTGGGAGCAGTGGCAGGG + Intronic
1069890226 10:71647993-71648015 CACACTTCGGAGCGGGGTCTTGG - Intronic
1074883503 10:117676866-117676888 CTCACCTCGGTCCCGGGGCAAGG + Intergenic
1076922243 10:133460027-133460049 CACACTTCGGAGCCGGGGCAGGG + Intergenic
1081730181 11:45366374-45366396 CACACTTCTGAGACTGGCCAGGG + Intergenic
1084677670 11:70645734-70645756 CAGACTGGGGAGCTGGGGCAAGG + Intronic
1089340022 11:117750930-117750952 CAGACTTCACAGCTGGGGCAGGG - Intronic
1102677697 12:114669287-114669309 CACACCTCGGAGGCGAGGCTGGG + Intergenic
1104190648 12:126479335-126479357 CACACTTCAGAACCCGGGGAAGG - Intergenic
1110805983 13:79754868-79754890 CACACTGCTGAGCCTGGCCAGGG + Intergenic
1112054448 13:95677348-95677370 CCCACTTCCTGGCCGGGGCAGGG - Intronic
1112508354 13:99988903-99988925 CACACTCAGGAGCCTGGGCCTGG + Intergenic
1116582097 14:46654688-46654710 CACACTTCGGAGGCGCGGTGCGG + Intergenic
1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG + Intronic
1122344404 14:101049708-101049730 CGCAGCACGGAGCCGGGGCAGGG - Intergenic
1127103164 15:55587987-55588009 CAAGCCTCGGAGCCGAGGCACGG + Intronic
1129612213 15:77070412-77070434 GACGCTGCGGAGCCGGGGCGGGG - Intronic
1131096055 15:89655032-89655054 CGCTATTCGGAGCCGGGGCAGGG + Intronic
1131832363 15:96361782-96361804 GACTCTCCGGAGCTGGGGCAAGG + Intergenic
1137531293 16:49280531-49280553 CAGGCTTCTGAGCCGGGGCAAGG + Intronic
1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG + Intergenic
1142136919 16:88455770-88455792 CAAACGTGGGAGCGGGGGCAGGG + Intronic
1142598050 17:1039195-1039217 CACCCTTCAGAGGCGGGTCAGGG + Intronic
1143004242 17:3817338-3817360 AACCCTTCTGAGCCCGGGCATGG + Intronic
1145252057 17:21302033-21302055 CACACGTCGGAGAGGGGGCTGGG + Intronic
1146370784 17:32264811-32264833 CGCAGTTCGGATCCTGGGCACGG + Intergenic
1148856875 17:50583778-50583800 GACACCTCGGGGCCAGGGCAGGG - Intronic
1151186793 17:72370797-72370819 CACACAGCGAAGCAGGGGCAAGG + Intergenic
1151557740 17:74855033-74855055 CGCTCTTCGGTGCCTGGGCAGGG - Exonic
1151916322 17:77120831-77120853 CACACATCGGAGCCCCAGCAGGG - Intronic
1151960966 17:77405463-77405485 TACACGTTGGAGCCGGGGCATGG + Intronic
1153762403 18:8344694-8344716 CACCCTTAGGAGGCTGGGCAGGG + Intronic
1154031613 18:10758220-10758242 CTCACTTAGGAGCTGGGGAATGG - Intronic
1154415446 18:14173339-14173361 GTCACTTCAGGGCCGGGGCAGGG + Intergenic
1157422828 18:47560488-47560510 CACACCTCAGATCCTGGGCATGG - Intergenic
1160802048 19:974675-974697 CCCACCTCGGAGCCTGGGGAGGG + Exonic
1160946345 19:1645671-1645693 CACACTCTGGAGCATGGGCAGGG - Intronic
1161667599 19:5586549-5586571 CACACTTGGCAGCCAGGGGAGGG + Intergenic
1165700394 19:37932947-37932969 CAGACTTCTGTGCCGGGGCTGGG + Intronic
926056391 2:9776402-9776424 CACACTTCATGGCCAGGGCAGGG - Intergenic
927848446 2:26484315-26484337 CACTCTTCCGAGGCAGGGCAGGG - Intronic
930640995 2:53854316-53854338 CACCATCCGGAGCCGGTGCAGGG + Exonic
935182937 2:100706336-100706358 GACACTCTGGAGCCGGGGCCAGG + Intergenic
935855083 2:107264785-107264807 CACACTTTGGGGCTGGGGGATGG + Intergenic
937984685 2:127633185-127633207 CCCACATCGGGGCTGGGGCATGG + Intronic
946426650 2:219601977-219601999 AACACCTCGGAGCTGGGACAAGG - Exonic
1169275033 20:4227950-4227972 CAAGCTTCGGAGCCGGGGGCGGG - Intronic
1170140996 20:13124809-13124831 CCCACTTCCGAGCCTGGGCCTGG - Intronic
1170603577 20:17859744-17859766 CACCTTTCTGAGCCGGTGCAAGG - Intergenic
1171342924 20:24444751-24444773 CGCACTTAGGAGCTGGGGGATGG + Intergenic
1174506917 20:51023016-51023038 CAAACTTCGGTCCCGGGGCCCGG + Exonic
1179034652 21:37749129-37749151 CTAACTTCTGAGCTGGGGCATGG + Intronic
1180048125 21:45319001-45319023 CTCACTTCAGAGCCAGGCCAAGG + Intergenic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
953462792 3:43095055-43095077 CACCCTGCTGAGCAGGGGCAAGG - Intronic
954554408 3:51506709-51506731 CACACTTCGTAAGCGGGGCATGG + Intergenic
962894073 3:139698400-139698422 CACACCTCTGGGCAGGGGCAGGG + Intergenic
963350980 3:144150654-144150676 TAAACTTCGGAGGCGGGGAAAGG - Intergenic
968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG + Intergenic
984711577 4:182889850-182889872 CACACCTGGGACCAGGGGCAGGG + Intergenic
987290712 5:16505718-16505740 CCCACCTTGGAGCCGGGGCCTGG - Intronic
998490321 5:142540831-142540853 CTCACTTGGGAGCGGGGGCTGGG + Intergenic
1002340078 5:178510249-178510271 CACACATTGGCGCCTGGGCATGG + Intronic
1002498988 5:179634998-179635020 CACAGCTGGGAGCGGGGGCAGGG - Intergenic
1002502688 5:179657526-179657548 CACAGCTGGGAGCGGGGGCAGGG + Intergenic
1023863585 7:44228674-44228696 CAGGCTGCGGCGCCGGGGCAGGG + Intronic
1025901632 7:65749812-65749834 CACAACTAGGAGCCGGGGCACGG - Intergenic
1029148288 7:98462379-98462401 CACACTTGGGAGCCTGGTGAAGG + Intergenic
1031053112 7:116965387-116965409 CACACATCGGAGCCTGTGGAAGG + Intronic
1033425438 7:141239597-141239619 CCCACTTCAGAGCGGAGGCATGG - Intronic
1049325615 8:142020016-142020038 CTCCCCTCGGGGCCGGGGCATGG + Intergenic
1049400539 8:142424795-142424817 CAAACCTCGGACCCAGGGCAGGG - Intergenic
1057406240 9:94773335-94773357 GACACTTAGGAGCCTGGGCATGG + Intronic
1059663847 9:116427226-116427248 CACACTTCACGACCGGGGCAAGG - Intronic
1060215145 9:121734435-121734457 CAGACTTCTGAGCAGGGGCTAGG + Intronic
1061801659 9:133116264-133116286 CACACTCCTGATCCTGGGCATGG + Intronic
1062500091 9:136848528-136848550 CCTACTTCGGAGCCAGGGGAGGG + Exonic
1197753221 X:129979827-129979849 CCCACTTCGGCGCCGGGGCTGGG + Intergenic
1198087174 X:133292718-133292740 CACAGGTTGGAGCCTGGGCAGGG - Intergenic