ID: 1076922993

View in Genome Browser
Species Human (GRCh38)
Location 10:133465285-133465307
Sequence GCTCCACGCGCCCGGAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076922993_1076923004 22 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076923004 10:133465330-133465352 CACCGTGTGCGACGATGGCTGGG 0: 1
1: 1
2: 3
3: 7
4: 30
1076922993_1076923002 17 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076923002 10:133465325-133465347 TGGGGCACCGTGTGCGACGATGG 0: 1
1: 1
2: 3
3: 6
4: 37
1076922993_1076922997 -10 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076922997 10:133465298-133465320 CGCGTGGAGCTCTGGCACGCGGG 0: 1
1: 0
2: 0
3: 13
4: 55
1076922993_1076923000 -1 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076923000 10:133465307-133465329 CTCTGGCACGCGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 142
1076922993_1076922999 -2 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076922999 10:133465306-133465328 GCTCTGGCACGCGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1076922993_1076923006 28 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076923006 10:133465336-133465358 GTGCGACGATGGCTGGGACCTGG 0: 1
1: 0
2: 0
3: 16
4: 322
1076922993_1076923003 21 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076923003 10:133465329-133465351 GCACCGTGTGCGACGATGGCTGG 0: 1
1: 1
2: 3
3: 10
4: 39
1076922993_1076922998 -3 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076922998 10:133465305-133465327 AGCTCTGGCACGCGGGCTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076922993 Original CRISPR GCTCCACGCGCCCGGAGCAG CGG (reversed) Intergenic