ID: 1076922995

View in Genome Browser
Species Human (GRCh38)
Location 10:133465293-133465315
Sequence GTGCCAGAGCTCCACGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 68}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076922995_1076923007 23 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076923007 10:133465339-133465361 CGACGATGGCTGGGACCTGGCGG 0: 1
1: 0
2: 0
3: 11
4: 117
1076922995_1076923000 -9 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076923000 10:133465307-133465329 CTCTGGCACGCGGGCTCCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 142
1076922995_1076923008 29 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076923008 10:133465345-133465367 TGGCTGGGACCTGGCGGACGCGG 0: 1
1: 0
2: 0
3: 17
4: 220
1076922995_1076923006 20 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076923006 10:133465336-133465358 GTGCGACGATGGCTGGGACCTGG 0: 1
1: 0
2: 0
3: 16
4: 322
1076922995_1076923003 13 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076923003 10:133465329-133465351 GCACCGTGTGCGACGATGGCTGG 0: 1
1: 1
2: 3
3: 10
4: 39
1076922995_1076922999 -10 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076922999 10:133465306-133465328 GCTCTGGCACGCGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1076922995_1076923002 9 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076923002 10:133465325-133465347 TGGGGCACCGTGTGCGACGATGG 0: 1
1: 1
2: 3
3: 6
4: 37
1076922995_1076923004 14 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076923004 10:133465330-133465352 CACCGTGTGCGACGATGGCTGGG 0: 1
1: 1
2: 3
3: 7
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076922995 Original CRISPR GTGCCAGAGCTCCACGCGCC CGG (reversed) Intergenic