ID: 1076922999

View in Genome Browser
Species Human (GRCh38)
Location 10:133465306-133465328
Sequence GCTCTGGCACGCGGGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076922993_1076922999 -2 Left 1076922993 10:133465285-133465307 CCGCTGCTCCGGGCGCGTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1076922999 10:133465306-133465328 GCTCTGGCACGCGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1076922995_1076922999 -10 Left 1076922995 10:133465293-133465315 CCGGGCGCGTGGAGCTCTGGCAC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1076922999 10:133465306-133465328 GCTCTGGCACGCGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076922999 Original CRISPR GCTCTGGCACGCGGGCTCCT GGG Intergenic