ID: 1076924495

View in Genome Browser
Species Human (GRCh38)
Location 10:133475632-133475654
Sequence GGCAAATGGGGCTCCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076924487_1076924495 -2 Left 1076924487 10:133475611-133475633 CCACCTGCCCTTGGTTTCACAGG No data
Right 1076924495 10:133475632-133475654 GGCAAATGGGGCTCCTGTGATGG No data
1076924490_1076924495 -9 Left 1076924490 10:133475618-133475640 CCCTTGGTTTCACAGGCAAATGG No data
Right 1076924495 10:133475632-133475654 GGCAAATGGGGCTCCTGTGATGG No data
1076924492_1076924495 -10 Left 1076924492 10:133475619-133475641 CCTTGGTTTCACAGGCAAATGGG No data
Right 1076924495 10:133475632-133475654 GGCAAATGGGGCTCCTGTGATGG No data
1076924489_1076924495 -5 Left 1076924489 10:133475614-133475636 CCTGCCCTTGGTTTCACAGGCAA No data
Right 1076924495 10:133475632-133475654 GGCAAATGGGGCTCCTGTGATGG No data
1076924485_1076924495 20 Left 1076924485 10:133475589-133475611 CCTGTGAATCTGGTGCAAGGCTC No data
Right 1076924495 10:133475632-133475654 GGCAAATGGGGCTCCTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076924495 Original CRISPR GGCAAATGGGGCTCCTGTGA TGG Intergenic
No off target data available for this crispr