ID: 1076925931

View in Genome Browser
Species Human (GRCh38)
Location 10:133487016-133487038
Sequence AAATAATAACAGATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076925931_1076925934 -5 Left 1076925931 10:133487016-133487038 CCTTGCTTCATCTGTTATTATTT No data
Right 1076925934 10:133487034-133487056 TATTTATTTTTGCAGTTGGGTGG No data
1076925931_1076925935 13 Left 1076925931 10:133487016-133487038 CCTTGCTTCATCTGTTATTATTT No data
Right 1076925935 10:133487052-133487074 GGTGGTTTTCTGTAGTGATAAGG 0: 11
1: 27
2: 27
3: 56
4: 269
1076925931_1076925933 -8 Left 1076925931 10:133487016-133487038 CCTTGCTTCATCTGTTATTATTT No data
Right 1076925933 10:133487031-133487053 TATTATTTATTTTTGCAGTTGGG No data
1076925931_1076925932 -9 Left 1076925931 10:133487016-133487038 CCTTGCTTCATCTGTTATTATTT No data
Right 1076925932 10:133487030-133487052 TTATTATTTATTTTTGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076925931 Original CRISPR AAATAATAACAGATGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr