ID: 1076926329

View in Genome Browser
Species Human (GRCh38)
Location 10:133490001-133490023
Sequence GTTCAGCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076926329_1076926331 4 Left 1076926329 10:133490001-133490023 CCTACAGCATGGTGCTGCTGAAC No data
Right 1076926331 10:133490028-133490050 ACTGTAATTTGCATCTTCTGTGG No data
1076926329_1076926332 30 Left 1076926329 10:133490001-133490023 CCTACAGCATGGTGCTGCTGAAC No data
Right 1076926332 10:133490054-133490076 AGTTTCAGAGCAGAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076926329 Original CRISPR GTTCAGCAGCACCATGCTGT AGG (reversed) Intergenic