ID: 1076927414

View in Genome Browser
Species Human (GRCh38)
Location 10:133499190-133499212
Sequence GACAGCTCTTAGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076927414_1076927416 11 Left 1076927414 10:133499190-133499212 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1076927416 10:133499224-133499246 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1076927414_1076927418 16 Left 1076927414 10:133499190-133499212 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1076927418 10:133499229-133499251 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1076927414_1076927417 15 Left 1076927414 10:133499190-133499212 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076927414 Original CRISPR GACAGCTCTTAGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr