ID: 1076928386

View in Genome Browser
Species Human (GRCh38)
Location 10:133507778-133507800
Sequence CCTTCCAGGGAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076928386_1076928395 19 Left 1076928386 10:133507778-133507800 CCTTCCAGTTTCTCCCTGGAAGG No data
Right 1076928395 10:133507820-133507842 CCAGTTACTGCTTAAGGATCAGG No data
1076928386_1076928393 13 Left 1076928386 10:133507778-133507800 CCTTCCAGTTTCTCCCTGGAAGG No data
Right 1076928393 10:133507814-133507836 AATTTTCCAGTTACTGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076928386 Original CRISPR CCTTCCAGGGAGAAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr