ID: 1076930327

View in Genome Browser
Species Human (GRCh38)
Location 10:133528055-133528077
Sequence GCTCTTGCGCGTGCGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076930324_1076930327 9 Left 1076930324 10:133528023-133528045 CCGTCAGCACGGAGCAGGCGCTG 0: 1
1: 0
2: 1
3: 26
4: 180
Right 1076930327 10:133528055-133528077 GCTCTTGCGCGTGCGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076930327 Original CRISPR GCTCTTGCGCGTGCGCTCTG TGG Intronic
No off target data available for this crispr