ID: 1076930658

View in Genome Browser
Species Human (GRCh38)
Location 10:133529692-133529714
Sequence GCTCTTGAGCGTGCGCTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076930655_1076930658 9 Left 1076930655 10:133529660-133529682 CCGTCAGCACAGAGCAGACGCTG 0: 1
1: 0
2: 1
3: 31
4: 234
Right 1076930658 10:133529692-133529714 GCTCTTGAGCGTGCGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076930658 Original CRISPR GCTCTTGAGCGTGCGCTCTG CGG Intronic
No off target data available for this crispr