ID: 1076933793

View in Genome Browser
Species Human (GRCh38)
Location 10:133554288-133554310
Sequence CTTCAACTCCACCATGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076933790_1076933793 18 Left 1076933790 10:133554247-133554269 CCATTTTTCCATGGAAACAGTGC 0: 1
1: 0
2: 1
3: 25
4: 233
Right 1076933793 10:133554288-133554310 CTTCAACTCCACCATGTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 156
1076933791_1076933793 10 Left 1076933791 10:133554255-133554277 CCATGGAAACAGTGCTCTGCAGT 0: 1
1: 0
2: 0
3: 34
4: 267
Right 1076933793 10:133554288-133554310 CTTCAACTCCACCATGTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 156
1076933789_1076933793 25 Left 1076933789 10:133554240-133554262 CCATGTTCCATTTTTCCATGGAA 0: 1
1: 0
2: 1
3: 36
4: 364
Right 1076933793 10:133554288-133554310 CTTCAACTCCACCATGTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076933793 Original CRISPR CTTCAACTCCACCATGTCAC TGG Intronic
901492025 1:9601557-9601579 GCTGAACTCCACCATGTCACTGG + Intronic
903404833 1:23087675-23087697 TTTCAACTTCCCCATGTGACTGG + Exonic
907198455 1:52706100-52706122 CTTCAACTCCCTCATTTTACAGG + Intergenic
910655038 1:89610343-89610365 CCTCAACTCCACCCTGTGATTGG + Intergenic
911365866 1:96936689-96936711 TTTCATCTTCACCATGCCACGGG - Intergenic
912499559 1:110113016-110113038 CTCCTTCTCCTCCATGTCACAGG - Exonic
915344974 1:155192834-155192856 TTTCACCACCACCATGACACCGG - Exonic
915986587 1:160471891-160471913 CTTCAACTCTACCATGTGAATGG + Intergenic
921152891 1:212415654-212415676 CTTCAGGTCCACCCTGCCACAGG - Intergenic
922714800 1:227862937-227862959 GTACAACTCCACCAGATCACTGG - Intergenic
923696052 1:236253581-236253603 CTTATTCACCACCATGTCACTGG - Intronic
1063049287 10:2429295-2429317 CTTCATGTCCACCATTTCAGTGG - Intergenic
1063473053 10:6304325-6304347 CCCCAAATCCACCATGTCTCAGG - Intergenic
1065973424 10:30822749-30822771 CCTCAACCTCATCATGTCACAGG + Intronic
1066447254 10:35494420-35494442 CGTCACCTCCACCATGTGTCAGG + Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067412659 10:46078553-46078575 CTTCAACTCCAGAATGTTCCTGG - Intergenic
1067692458 10:48510606-48510628 CTCCACCTCCACCATTTCAAAGG + Intronic
1068127498 10:52859051-52859073 CTTCAACTCCACTCTTTCTCAGG - Intergenic
1069555002 10:69392140-69392162 CTTCATCTCCTCCATGTAGCAGG - Exonic
1070743436 10:78917783-78917805 CTCCAACTACACCCAGTCACGGG + Intergenic
1074172889 10:110961260-110961282 CTTCAACTCCACTATGTTTTGGG - Intronic
1075622501 10:123938372-123938394 CTGCAGCTCAACCATGTCAAGGG + Intronic
1076933793 10:133554288-133554310 CTTCAACTCCACCATGTCACTGG + Intronic
1077037411 11:502153-502175 CTTCACCTCCACCATGAGCCTGG - Exonic
1077413844 11:2415448-2415470 CATCACCTCCTCCAGGTCACAGG + Exonic
1078382519 11:10857531-10857553 CCTCAGCTCCTCCCTGTCACAGG + Intronic
1078707310 11:13757061-13757083 ATTCAACTCCATGATGTTACTGG - Intergenic
1079239065 11:18709621-18709643 CTCCAACTCCAGCATTTCCCTGG - Exonic
1080679853 11:34464383-34464405 CTTCAACTCCACCCAGTAAGGGG - Intronic
1084723436 11:70924406-70924428 CTTCAGCCCCACCATTTCGCTGG - Intronic
1085638887 11:78178900-78178922 CTCCCACTCCACCATGTCTCAGG + Intronic
1086589534 11:88495802-88495824 CTTCAATTCCACCAAACCACTGG + Intergenic
1091566848 12:1655197-1655219 CTGCATCGCCAGCATGTCACAGG - Intergenic
1093189099 12:16054812-16054834 CTCCACCTCCACCATCTGACAGG - Intergenic
1096536010 12:52275141-52275163 CTTTTACTCCACGATCTCACTGG - Intronic
1101493693 12:105234332-105234354 CTTCATCTCCACCCTGTAGCTGG - Intronic
1103958965 12:124595545-124595567 CTTCCACTCCTCCATGACCCCGG + Intergenic
1111396970 13:87677091-87677113 CTTCATGCCCACAATGTCACAGG - Exonic
1111900265 13:94191398-94191420 CTTCAACTCAAACTTGACACTGG - Intronic
1112219321 13:97471910-97471932 CTCCAGTTGCACCATGTCACAGG + Intergenic
1113141972 13:107163063-107163085 CATCTACTCCACAATGCCACGGG - Intergenic
1113449681 13:110398795-110398817 CTCCAACTCCACCCTGCCTCTGG - Intronic
1117049670 14:51847522-51847544 CTTCAGCTCCAGGATGTGACAGG - Intronic
1117331749 14:54719324-54719346 CTTCAAGTCTACTCTGTCACGGG - Intronic
1119217399 14:72879614-72879636 CTCCACCTCCACCCTGTCCCTGG - Intronic
1119380631 14:74225983-74226005 CTTCATCGCCATCATGTCCCTGG + Intergenic
1119902597 14:78274018-78274040 CTTCAACTCCCCCATGCCTCTGG - Intronic
1121081875 14:91114914-91114936 CATCAACACCAACATGGCACAGG + Intronic
1122374039 14:101246940-101246962 CCTCAACTCCCACATGTCTCAGG + Intergenic
1122816041 14:104314614-104314636 CTGCAACTCCACCTTTTCCCTGG + Intergenic
1123430001 15:20206582-20206604 GTTTAACTCCAACATGTCCCAGG + Intergenic
1125325064 15:38528032-38528054 CCCCAAATCCACCATTTCACTGG + Intronic
1127395149 15:58538472-58538494 CTTCAACTCCTCCCTGCCTCTGG + Exonic
1128567336 15:68710197-68710219 CTTCAAGTCCACCATCTCTCAGG + Intronic
1129304293 15:74647746-74647768 CCCCAACTCAACCAAGTCACTGG + Intronic
1131064886 15:89428082-89428104 CCTCAACACAATCATGTCACTGG - Intergenic
1132184629 15:99792457-99792479 CTTCATCTCCTCCATGTCCTGGG - Intergenic
1133317268 16:4892531-4892553 CTACGACTCCACCCAGTCACGGG + Intronic
1136854635 16:33644637-33644659 ATTTAACTCCAACATGTCCCAGG - Intergenic
1137868302 16:51924318-51924340 CTACAACTCCAGCAAGTCCCAGG - Intergenic
1138237537 16:55397595-55397617 CTTCATCCCTGCCATGTCACTGG - Intronic
1138414831 16:56865652-56865674 CTGCAGCTCCACTATTTCACTGG - Intronic
1139395316 16:66634059-66634081 CTACCACACTACCATGTCACCGG - Intronic
1140060787 16:71568023-71568045 CCTCAAATGCACCATGTCAAGGG - Exonic
1140356985 16:74314889-74314911 CTGCAATTCCTACATGTCACTGG - Intergenic
1140895719 16:79322708-79322730 CTTCAAGTCCACCTTGACCCCGG - Intergenic
1203116211 16_KI270728v1_random:1493106-1493128 ATTTAACTCCAACATGTCCCAGG - Intergenic
1143325161 17:6093797-6093819 CTGCAACTCTGCCATGTCTCGGG - Intronic
1143382797 17:6507031-6507053 CTTATACTCCACCATGTCTTGGG - Intronic
1145883545 17:28368220-28368242 CTTTCCCTCCACCATATCACTGG + Intronic
1146470753 17:33122348-33122370 CTTCAAATCCATCATGTCATGGG - Intronic
1150416668 17:64994105-64994127 CTTCATCACCCCCATGTCAGGGG - Intergenic
1150794990 17:68229776-68229798 CTTCACCACCCCCATGTCAGGGG + Intergenic
1151701011 17:75742585-75742607 CTGGAACTCCACCATGCCCCGGG - Exonic
1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG + Intergenic
1160460944 18:79037553-79037575 CCTCCCCTCCACCATGTCTCAGG + Intergenic
1161883025 19:6970906-6970928 GATCAACTCCAGAATGTCACAGG - Intergenic
1162866766 19:13553982-13554004 CTTCACCTTGAGCATGTCACAGG + Intronic
1164709222 19:30343517-30343539 CTTCATCTCCACCTGGGCACAGG - Intronic
1164842465 19:31402837-31402859 CTTGAACTACACAATGTCAGTGG + Intergenic
1166696628 19:44855460-44855482 CTTCACCTCCTCCAAGTCCCTGG - Intronic
926149510 2:10416928-10416950 CCTCAACTCCTCCATGAAACAGG + Intronic
932044373 2:68332737-68332759 CTTCAACTCTACCTTCTCAGAGG - Intergenic
932614524 2:73223449-73223471 CTTCAACTCCAGAGTGTCACAGG - Exonic
940144642 2:150533409-150533431 CTTCATCACCACCATATCAATGG + Intronic
944260512 2:197670917-197670939 CTTCAAATCCAGCCAGTCACAGG + Intronic
945596785 2:211805243-211805265 ATTCAACTCCTCCATGCCATAGG + Intronic
1168938434 20:1687936-1687958 CTTCAAACCCAGCATGTGACAGG - Intergenic
1172906387 20:38373275-38373297 CTTCAACGATCCCATGTCACAGG - Intronic
1173363090 20:42361765-42361787 CTTCAGCTCCACAATGTCTAGGG - Intronic
1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG + Intergenic
1176868749 21:14071162-14071184 CTGCAGCTCCACCAGGTCCCCGG + Intergenic
1178806388 21:35843129-35843151 CTTGAACTGAGCCATGTCACTGG + Intronic
1179261997 21:39765605-39765627 CTTCAACTGCACCGTCTCCCAGG + Exonic
1185025157 22:48404755-48404777 CTTCAGCTCTCACATGTCACAGG - Intergenic
950741627 3:15056859-15056881 CTGGAACTCCACCCTGTGACTGG + Intronic
958983564 3:100753902-100753924 CATCATCTTCACCATGCCACTGG - Intronic
958986197 3:100782227-100782249 ATGCAAGTCCACCAAGTCACAGG + Intronic
959544310 3:107576220-107576242 CTTCAACTTCAGCATATCACTGG - Intronic
961734489 3:128993061-128993083 CTGCAAATTCACCATCTCACTGG - Exonic
962249581 3:133827617-133827639 CTTCAACTGCGCCATGCCACTGG + Exonic
962653163 3:137516577-137516599 TTTCAGCTCCACCATTTTACAGG + Intergenic
967644228 3:191901748-191901770 CTTCACCTCCTCCTTCTCACTGG + Intergenic
970102860 4:12545200-12545222 CTTAAACTCCAACATGGCAATGG - Intergenic
970675052 4:18439453-18439475 TTCCAACTCCTCCAGGTCACGGG - Intergenic
970899760 4:21145170-21145192 CTGCAACTCCACCTACTCACAGG + Intronic
974442267 4:61934686-61934708 CTTCTGCTGCAGCATGTCACAGG + Intronic
975128481 4:70808553-70808575 CTTCAGCTTCACCAAGTAACAGG - Intergenic
977022892 4:91777584-91777606 CTTCAACTCCAACCTCTCAGTGG - Intergenic
977579105 4:98705081-98705103 CTACAGCTGCACCATGTCCCTGG + Intergenic
978655801 4:111064114-111064136 CTCCAACTCCACCCTGTTTCTGG - Intergenic
980101402 4:128544770-128544792 ATTCAACTCCCCCATGTCCTTGG - Intergenic
980513039 4:133818767-133818789 GTTCAACACCACCATATCATAGG - Intergenic
980705751 4:136491302-136491324 CATCAACTGCACAATGTCATAGG + Intergenic
984914555 4:184710113-184710135 ATTCAACTCCTTGATGTCACTGG + Exonic
991047231 5:62235539-62235561 GTTTAACTCCAACATGTCCCAGG + Intergenic
994605894 5:101966141-101966163 ATTATACTCCACAATGTCACTGG - Intergenic
994947383 5:106413650-106413672 CTTCAGCTTCACCAAGTAACAGG + Intergenic
995924356 5:117352619-117352641 CTCCCCCACCACCATGTCACAGG - Intergenic
998523223 5:142818963-142818985 CTTCAACTCCACCTGGACATTGG + Intronic
998599484 5:143570519-143570541 CTTCCACTCTGCCATCTCACTGG + Intergenic
1002185535 5:177453129-177453151 CTTCAACACCACCTTGTCTGTGG - Intronic
1003583451 6:7363694-7363716 CTTCCTCTGCACCATGTCAAGGG + Intronic
1003931341 6:10927255-10927277 CATAAACTCCACCATGTTAGTGG - Exonic
1007057135 6:38897663-38897685 CCTCAACTCCCCCAAGTCGCGGG - Intronic
1009603244 6:65831688-65831710 CTACAACTTCACCAGGCCACGGG - Intergenic
1010549167 6:77200365-77200387 CTACAACTCCCACATGTCATGGG + Intergenic
1011145480 6:84210349-84210371 CTTTAACTCCAACATGGCAGAGG - Intronic
1012615901 6:101279795-101279817 CTTCAGTTCCACCAAGTGACAGG + Intergenic
1012860305 6:104551543-104551565 CTTCCACCCCACCAGGTGACAGG + Intergenic
1018856716 6:167680235-167680257 CTTCTCCTCCACCATGTCTCAGG + Intergenic
1019118043 6:169781575-169781597 CCTCAACTCCACCCTGTCTTTGG - Exonic
1019518183 7:1448690-1448712 CTTCAAGGCCACCATGTCCTCGG + Exonic
1021633570 7:22669231-22669253 CTTCACCTCCACCAGCTCTCAGG + Intergenic
1022289881 7:28990673-28990695 GTTCAACTCCACCATCACACAGG - Intergenic
1022837317 7:34130641-34130663 CATCTACTCCACCATGCCCCAGG - Intronic
1023015787 7:35968041-35968063 CTTCAGCTGCAGCCTGTCACTGG + Intergenic
1023891534 7:44395580-44395602 CCTCAACCCCACCAAGCCACTGG + Intronic
1024294880 7:47833851-47833873 CTCCAACTGCCCCGTGTCACAGG + Intronic
1026979589 7:74518455-74518477 CTTCACCTCCACCATCAGACTGG - Intronic
1027975552 7:85149693-85149715 ATTCACTTCCACCATGTCAGAGG + Intronic
1031286091 7:119869771-119869793 CATAATCTCCACCATGTCAAGGG + Intergenic
1033155010 7:138949290-138949312 CATCAACCCCTCCATGTCATGGG + Intronic
1034444786 7:151108295-151108317 CTACAATACCGCCATGTCACCGG + Intronic
1034652594 7:152703260-152703282 TTTCAATTCCACAATGCCACAGG - Intergenic
1038464055 8:27743591-27743613 CTTCAAGACCACCATATCAGGGG + Intronic
1042433925 8:68742079-68742101 CTTGAACTCCAGCGTGTCAGTGG + Intronic
1044802436 8:95971101-95971123 CTTCAAATCAGACATGTCACTGG - Intergenic
1044924460 8:97198414-97198436 CATGAACTCCATCATGTGACTGG - Intergenic
1045808363 8:106192037-106192059 CTTCAAATCCACCATTTTAAAGG - Intergenic
1046741625 8:117835300-117835322 CTTCATATTCACCATGACACAGG + Intronic
1047486518 8:125335728-125335750 CTTCATCTCCTCTATCTCACTGG - Intronic
1047664205 8:127072758-127072780 CATAAACTAAACCATGTCACAGG + Intergenic
1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG + Intronic
1053461031 9:38271727-38271749 AGTCAACTCCACCCTGTCACAGG - Intergenic
1054159416 9:61663586-61663608 CTACAACCCCACCAGGGCACAGG - Intergenic
1054479188 9:65594591-65594613 CTACAACCCCACCAGGGCACAGG - Intergenic
1054801901 9:69358178-69358200 CTTCAATTCCATTATGTCAAAGG - Intronic
1057197285 9:93122092-93122114 CCTCATCTGCACCATGTCCCCGG - Exonic
1058988010 9:110227294-110227316 ATTCAACTCCCACATGTCATGGG + Intergenic
1062369516 9:136230587-136230609 CCACAAATCCACCCTGTCACTGG + Intronic
1186007777 X:5093402-5093424 CTGCACCTCCACCCTCTCACAGG - Intergenic
1189645191 X:43120640-43120662 CTTCCACTCCACCTTATCTCTGG - Intergenic
1192758071 X:74066731-74066753 CTTCACCTGCATCATGTCTCTGG - Intergenic
1195259147 X:103115826-103115848 CTTGACCTGCACCATCTCACTGG - Intergenic
1198646511 X:138812846-138812868 CCTCAACCCCACCCTGTAACAGG + Intronic
1200699520 Y:6390297-6390319 CTTCTTCTCCACCAAGCCACAGG + Intergenic
1200963799 Y:9018490-9018512 CTTTTCCTCCACCAAGTCACAGG + Intergenic
1201034591 Y:9774401-9774423 CTTCTTCTCCACCAAGCCACAGG - Intergenic