ID: 1076934258

View in Genome Browser
Species Human (GRCh38)
Location 10:133556834-133556856
Sequence CCACAGGCATGAGGGGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076934243_1076934258 24 Left 1076934243 10:133556787-133556809 CCCATCAGATCTTCCAGCTGTTC 0: 1
1: 0
2: 2
3: 18
4: 193
Right 1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1076934248_1076934258 2 Left 1076934248 10:133556809-133556831 CCTCGAATGCCAACCTGGGAACC 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1076934249_1076934258 -7 Left 1076934249 10:133556818-133556840 CCAACCTGGGAACCAACCACAGG 0: 1
1: 0
2: 3
3: 19
4: 189
Right 1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1076934244_1076934258 23 Left 1076934244 10:133556788-133556810 CCATCAGATCTTCCAGCTGTTCC 0: 1
1: 0
2: 0
3: 25
4: 280
Right 1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1076934245_1076934258 11 Left 1076934245 10:133556800-133556822 CCAGCTGTTCCTCGAATGCCAAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG 0: 1
1: 0
2: 0
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076934258 Original CRISPR CCACAGGCATGAGGGGATAT GGG Intronic
900957548 1:5896198-5896220 CCACAGGGATGAGGGGAGCAGGG + Intronic
901941043 1:12661883-12661905 CCACAGGGGTGAGAGGAGATAGG + Intronic
902533866 1:17107718-17107740 CCACAGACTTCAGGGGCTATGGG + Intronic
904843259 1:33388093-33388115 CCACAGGAGAGAGGGGATAGAGG + Intronic
906217719 1:44053543-44053565 CCTCCGGCAGTAGGGGATATGGG - Intergenic
906431636 1:45760294-45760316 CCACTAGGAGGAGGGGATATTGG - Intergenic
907145056 1:52224075-52224097 CCACTAGGAGGAGGGGATATTGG - Intronic
917599416 1:176559585-176559607 CCACAGGCATGAGTAGATTAGGG - Intronic
918124501 1:181570952-181570974 TCACAGAATTGAGGGGATATTGG - Intronic
1064483837 10:15765556-15765578 ACCCAGGCAGGATGGGATATGGG - Intergenic
1067192107 10:44080295-44080317 CCACAGACATGAAGGGACAGGGG + Intergenic
1067696964 10:48542633-48542655 CCACAGGCATGAGGAGGGCTGGG + Intronic
1068020384 10:51575118-51575140 CCACAGGCATCACTGTATATAGG - Intronic
1070652509 10:78247996-78248018 CCACAAGCCTCAGGGGAAATGGG - Intergenic
1071067816 10:81656759-81656781 CCAGAGGCATGAGGCTATATGGG + Intergenic
1071127537 10:82352696-82352718 GCAAAGGCCTGAGGGGACATGGG + Intronic
1073146707 10:101285993-101286015 CCACAGGCAGGAGGGGGCAAGGG - Intergenic
1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG + Intronic
1078911785 11:15739433-15739455 CTAAAGACATGTGGGGATATGGG - Intergenic
1079505292 11:21146478-21146500 CCACAGCTATGAGGTGATAAAGG - Intronic
1080563833 11:33489803-33489825 GCTCAGGAATGAGGGGAAATGGG + Intergenic
1082006535 11:47422459-47422481 CCAGGGGCAGGAGGGGATACAGG + Intronic
1083664771 11:64268456-64268478 TCACAGGGATGAGGGGATGCTGG - Intronic
1087976939 11:104562259-104562281 CCACATGGAGGAGGTGATATTGG - Intergenic
1089629374 11:119774550-119774572 CTGCAGGCAGGAGGGGGTATTGG + Intergenic
1090190022 11:124761403-124761425 CCAAAGGGAAGAGGGGAAATTGG - Intronic
1095281545 12:40357093-40357115 CCAGAGGCTTGGGAGGATATGGG - Intronic
1099568514 12:84283185-84283207 CCTGAGTCATGAGGAGATATAGG + Intergenic
1103098849 12:118154918-118154940 CCACTGGCTTGGGGGGATAAGGG - Intronic
1103956740 12:124581663-124581685 TCATGGGCATGAGGGGATTTTGG + Intergenic
1105863916 13:24442098-24442120 CCACAAGCGTGAGGGGAAGTGGG + Intronic
1106089651 13:26578855-26578877 CAACAGTCATGAATGGATATTGG + Intronic
1108073648 13:46656109-46656131 CCAGAGGAATGTGGGGATACGGG - Intronic
1108484650 13:50911152-50911174 GAACAGGCATGAGGCGTTATTGG - Intronic
1108758175 13:53529584-53529606 CCACAGGCCTGTGGGGAGTTTGG + Intergenic
1108852982 13:54758209-54758231 CCATAGGCATGACGGTATAAAGG - Intergenic
1112355301 13:98669723-98669745 CCACGTGCATGAAGGCATATGGG + Intergenic
1117184590 14:53227247-53227269 CCACTGGCCTGGGGGCATATCGG + Intergenic
1118380426 14:65213543-65213565 CCACAGGGAGGAGGGTATAATGG + Intergenic
1119549414 14:75497457-75497479 CCACAGTCCTGAGGGGGTGTAGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1127510952 15:59640570-59640592 CAACAGCCATGAGTGGCTATTGG + Intronic
1128040847 15:64572122-64572144 GCAAAGGCCTGAGGGGAAATGGG + Intronic
1128239872 15:66094487-66094509 ACACAGGGCTGAGGGGACATGGG + Exonic
1129026537 15:72580092-72580114 CCAGAGGCTTGCGGGGATAGAGG - Intronic
1130975346 15:88769406-88769428 CCACAGGCCTTAGGAGAGATGGG + Intergenic
1133727464 16:8550788-8550810 CCACAAGCATGTGTGGATATGGG - Intergenic
1136415170 16:30098403-30098425 CCACTGGGAGGAGGGGGTATTGG + Intergenic
1137913736 16:52405605-52405627 CCACAGGCATGAGGAGATCCAGG - Intergenic
1140307775 16:73819739-73819761 CCACAGGGATGAGGGCTCATAGG + Intergenic
1140936314 16:79673668-79673690 CCACCGGTGTGGGGGGATATTGG + Intergenic
1143371239 17:6441385-6441407 TCACAGGCAAGAGGGAATATGGG + Intergenic
1143769229 17:9157462-9157484 CCACAGGCATGTGTTGAAATAGG + Intronic
1143956308 17:10672609-10672631 CCAGGGGCAGGAGGGGATTTGGG - Exonic
1152920422 17:83063884-83063906 CCACAGGCATCCGGGGATGCGGG - Intergenic
1153609167 18:6864963-6864985 GCATAGGAATGGGGGGATATGGG - Intronic
1156473556 18:37392116-37392138 CCACAGTGATGAGCAGATATGGG - Intronic
1158827765 18:61242704-61242726 CAACAGGCATGAGTGGACGTGGG + Intergenic
1160779704 19:872385-872407 CCACGTGCAGGTGGGGATATTGG - Intronic
1162737214 19:12753399-12753421 CAAAAGGCATGAATGGATATGGG - Intronic
1163313081 19:16525593-16525615 CAACAGCCATGAGGGCATGTGGG - Exonic
1164457458 19:28420678-28420700 ACACAGGGATCAGAGGATATGGG - Intergenic
1165125781 19:33596111-33596133 CCATAGGAAAGAGGGGATGTAGG - Intergenic
1166748958 19:45155687-45155709 CCACAGGGGTGGGGGGATCTGGG + Intronic
925896526 2:8476548-8476570 CAGCAGGAATGAGGTGATATGGG + Intergenic
926801430 2:16664202-16664224 CCAGAGGCAGGAGGGAATGTGGG + Intronic
927824984 2:26302137-26302159 CCACAGGCAGCAGGGGAACTGGG - Intergenic
927981539 2:27377894-27377916 CCACAGGCATAAGGGCAGAGGGG + Exonic
935594307 2:104867568-104867590 CCACAGGCCTGAGCGGGTAGGGG + Intergenic
937831414 2:126428615-126428637 AGACAGGCATGAGGGGAAAGTGG - Intergenic
940771363 2:157842379-157842401 CCAAAGGCATGAATGAATATGGG - Intronic
944583428 2:201152890-201152912 CCACAGGTATGAGCAGGTATTGG + Intronic
947521148 2:230847036-230847058 CCACAGGGATAAGGGCATGTGGG - Intergenic
948667722 2:239546662-239546684 CCACGGCCATGAGGGGCTGTGGG + Intergenic
1172126091 20:32626198-32626220 CCACAGGCATGCTGGGAAGTGGG - Intergenic
1179634187 21:42696829-42696851 GCACAGGCATCAGGGGCTAGAGG + Intronic
1180135799 21:45861054-45861076 CCAGAGGCAGGAGGGGAACTGGG - Intronic
1180136212 21:45863527-45863549 CCAAGGGCATGAGGGGAGCTGGG + Intronic
1182076492 22:27498987-27499009 CCACAGGCTTCTGGGGATCTGGG - Intergenic
1182659108 22:31912583-31912605 CCATGGGGATGAGGGGAGATGGG + Intergenic
1182963971 22:34504361-34504383 CCTCAGGCAGCAGGGGATATAGG - Intergenic
1183440910 22:37822623-37822645 CCACAGGCAGTAGGAGACATGGG + Intergenic
1183484666 22:38082535-38082557 CCACAGGCAGGAAGGGACTTCGG + Intronic
1183831639 22:40421218-40421240 CCACAGGGAAGAGTGGAAATGGG - Intronic
1184350071 22:43937542-43937564 CCACAGGCAGGAGCCTATATGGG - Intronic
1184611595 22:45607405-45607427 GCACAGGCCCGAGAGGATATGGG - Intergenic
949333682 3:2950221-2950243 CCACAGGCATGTGCTGACATGGG + Intronic
949871116 3:8589972-8589994 CCACAGGAATGCTGGGATTTTGG - Intergenic
949965369 3:9351535-9351557 CCTCAGGGAGGAGGGAATATGGG - Intronic
952979182 3:38721367-38721389 CCAAAGGCATGAGGGGCTTCAGG - Intronic
954324871 3:49858068-49858090 CCACAGGCATGCAGGGAGAAGGG + Exonic
955791357 3:62591613-62591635 CCACAAGCAGGTGGGGTTATTGG + Intronic
958079694 3:88730929-88730951 CACCAGGCATGACAGGATATAGG - Intergenic
965770645 3:172178206-172178228 CCACAGTCATCAGGGAATAGAGG + Intronic
967934502 3:194716111-194716133 CCACAGGCAGGAGGGCAACTAGG - Intergenic
969576502 4:8039079-8039101 CCACAGTCTTGAGGGGATAAGGG - Intronic
974604476 4:64133135-64133157 CTACAGGCATGTGGGCATGTGGG - Intergenic
975570143 4:75808104-75808126 CCTCGGGGATGGGGGGATATGGG + Intronic
977300658 4:95263393-95263415 ACAAAGGCATGAGAGGATAGTGG + Intronic
982696013 4:158601431-158601453 CAACAGGCATTTGGAGATATAGG + Intronic
983072046 4:163279577-163279599 CCATATGCAGGAGAGGATATGGG + Intergenic
984088638 4:175343172-175343194 CCCCAGGCATGAGCAGGTATTGG + Intergenic
984958507 4:185070456-185070478 CCACAGGAAAGAGGAGAGATGGG + Intergenic
985781098 5:1872291-1872313 GCACAGGGATGAGGGGAGACAGG - Intergenic
986228605 5:5840805-5840827 CCATAGGCATGAAGGGATAAGGG + Intergenic
992434305 5:76740569-76740591 CCACAGGCATGGGGGGTGGTGGG - Intergenic
994581203 5:101644562-101644584 GCACTGGGATCAGGGGATATGGG - Intergenic
995112937 5:108447420-108447442 TCACTGGATTGAGGGGATATGGG + Intergenic
995313490 5:110739422-110739444 ACACAGGGATGAGGGGTTACTGG + Intronic
996881488 5:128301831-128301853 CCACAGGCAGGAGGATATGTGGG + Intronic
1002114623 5:176949616-176949638 CCACTGGCATTAGGGAATCTTGG + Intronic
1003460430 6:6323406-6323428 CCACATGGATGAGGGTATCTTGG - Intergenic
1004975002 6:20955482-20955504 CCACAGGAGTGTGGGGAGATTGG - Exonic
1005574669 6:27179960-27179982 CCACTAGGAGGAGGGGATATTGG + Intergenic
1007321726 6:41032819-41032841 CCACAGGAATGAAGGGTTCTGGG - Intronic
1007426534 6:41749663-41749685 CCACAGGCAGGAGAGGACTTGGG - Intronic
1008495050 6:52124673-52124695 CCACAGGAAAGAAGGGATGTGGG + Intergenic
1009354397 6:62723592-62723614 ACACAGGCATGAGTGGTTCTTGG - Intergenic
1011359683 6:86510602-86510624 CCACAGGCCTGAGGTGATGGTGG - Intergenic
1013824317 6:114193320-114193342 CCTCATACATGAGGTGATATAGG + Intronic
1014192320 6:118511375-118511397 CCACCTGCATGAGAGGATAAGGG - Exonic
1019737722 7:2658918-2658940 CCTGAGGCATGAGGGGAGAGAGG - Exonic
1021053885 7:16022725-16022747 CCAAAGGCTTGATGTGATATTGG - Intergenic
1022066412 7:26863874-26863896 CCACAGGTGTTAGGGGTTATGGG - Intronic
1025146156 7:56506055-56506077 CCACAGGCATGTGGCAATTTTGG + Intergenic
1029656087 7:101925439-101925461 CCCCAGGGGTGAGGGGATAGAGG + Intronic
1030170658 7:106599443-106599465 CCCCAGGCATGAAGGGATAAGGG - Intergenic
1033030908 7:137825473-137825495 CAACAGCCATGATGGGAAATAGG + Intronic
1037510647 8:19578428-19578450 CCACACGCAAGAGAGGCTATAGG - Intronic
1037844253 8:22268721-22268743 CCACAGGCCTGAGAGGTTAAGGG - Intergenic
1038229554 8:25687614-25687636 CCACAGGAATGAGGGTAAACTGG - Intergenic
1038748819 8:30277728-30277750 CCACAGGTATCTGGGGATCTGGG - Intergenic
1039189344 8:34954356-34954378 GCACAGTTATGAGGGGATGTAGG + Intergenic
1043074428 8:75678597-75678619 ACACAGGCATCAGCGAATATAGG - Intergenic
1043866160 8:85378110-85378132 CCACAGGCTGGAGGGGGAATGGG + Exonic
1046344394 8:112903499-112903521 ACCCTGGCATGAGGGGATAGAGG + Intronic
1046928566 8:119820634-119820656 CCACAGGCATTATGGCATAGTGG - Intronic
1048444889 8:134485941-134485963 GCACAGGCATGTGGGGAACTCGG - Intronic
1049324888 8:142016726-142016748 CCCCAGGGATGAGGGGACGTTGG + Intergenic
1052826416 9:33179047-33179069 CCACAGGCTTTATGAGATATTGG - Intergenic
1056436005 9:86576709-86576731 GCACAGGCAGGAGGGGACAATGG - Intergenic
1061861234 9:133469678-133469700 CCACAGGGCAGAGGGAATATGGG - Exonic
1185712902 X:2318395-2318417 CCACTGGCATGAGAGGAGGTCGG + Intronic
1189545921 X:42042593-42042615 CCCCAGGCAGGAAGGGACATTGG + Intergenic
1189700778 X:43715155-43715177 CCACAGGGAAGAGGGTACATAGG + Intronic
1189701964 X:43721098-43721120 CCACAGGTATGTGGGGAGATAGG + Intronic
1191952151 X:66604325-66604347 GAAAAGGTATGAGGGGATATGGG + Intronic
1192484798 X:71515741-71515763 ACACCGGGATGAGGGAATATTGG - Intronic
1196714958 X:118801975-118801997 CCCCAGGGATGAGGGGAGAGTGG - Intergenic
1196960444 X:120994375-120994397 TTACAGGCATGAGGGGAGGTGGG + Intergenic
1197650289 X:129056797-129056819 CCACAGTGATGTGGGGATCTGGG - Intergenic
1199745524 X:150769908-150769930 CCACAGGCAAGAGGGAACTTGGG - Intronic
1201972845 Y:19815822-19815844 CCACAGGGTGGAGGGGCTATTGG - Intergenic