ID: 1076934837

View in Genome Browser
Species Human (GRCh38)
Location 10:133560451-133560473
Sequence GGGTATAAAAAACTGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076934833_1076934837 4 Left 1076934833 10:133560424-133560446 CCTGATATAATTCAAGAAAAAAA 0: 1
1: 0
2: 3
3: 100
4: 1024
Right 1076934837 10:133560451-133560473 GGGTATAAAAAACTGGAGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076934837 Original CRISPR GGGTATAAAAAACTGGAGCA AGG Intronic
902863900 1:19265028-19265050 CTGTATAAAAGACTGGAGAAGGG - Intergenic
905181025 1:36166746-36166768 GGGGAACAAAGACTGGAGCAGGG + Intronic
906150560 1:43585121-43585143 GGGAAAGAAAAACTGGAGCTGGG - Intronic
908212000 1:61910359-61910381 GGGAATAAGTAACTTGAGCATGG - Intronic
912822281 1:112877583-112877605 GTGTATAAAAAATTTGAGCTTGG + Intergenic
913135923 1:115888969-115888991 GGGTACAGAGAGCTGGAGCAGGG - Intergenic
916224268 1:162474227-162474249 GTGTAGAAAAAACTAGAGAATGG + Intergenic
916340085 1:163723786-163723808 GGCTACAAAAAACTGGAGGTAGG + Intergenic
918452971 1:184677771-184677793 GGGTAGAAAAAAGTGGTGAATGG + Intergenic
918861834 1:189837799-189837821 TGGTCGAAAAATCTGGAGCAAGG + Intergenic
920292230 1:204931395-204931417 TGGGATAAAAAAATGTAGCAGGG - Intronic
1065824008 10:29553276-29553298 GGCTATAAAAAGCAGCAGCATGG + Intronic
1068615905 10:59116358-59116380 AGGTATCAAGAACTGGAACAAGG - Intergenic
1070335883 10:75454832-75454854 GGGTATAGAAAAATGGAGCCTGG + Intronic
1072283137 10:93888388-93888410 GGGTACACAGAAATGGAGCAGGG + Intergenic
1074362900 10:112837350-112837372 GGGGATAGAAGACTGGAGGATGG + Intergenic
1074527502 10:114275032-114275054 GGGTGTGAGAATCTGGAGCATGG + Intronic
1075392250 10:122100756-122100778 TGGTATAAAAATGTGGAGAAAGG + Intronic
1076934837 10:133560451-133560473 GGGTATAAAAAACTGGAGCAAGG + Intronic
1077798306 11:5514205-5514227 TGGTATATGAAACTTGAGCATGG - Intronic
1080087984 11:28309557-28309579 GGTGATAAAAATCTGGACCATGG - Intronic
1081378962 11:42391747-42391769 GGGTTGATATAACTGGAGCAAGG - Intergenic
1081772228 11:45657094-45657116 GGGTCCCAAGAACTGGAGCAAGG + Intronic
1084474945 11:69383542-69383564 GAGAAGAAAAAGCTGGAGCATGG + Intergenic
1085592356 11:77775632-77775654 AGGTATTTAAAACTTGAGCAGGG + Intronic
1086276699 11:85138520-85138542 GGGTATAAGAAGGTGGAGTATGG - Intronic
1090325197 11:125879956-125879978 GGGGATAATACACTTGAGCATGG - Intergenic
1092994917 12:13940717-13940739 TGGTAGAAAAAAAGGGAGCAGGG + Intronic
1093511632 12:19936122-19936144 TGGTCTAAAGCACTGGAGCATGG - Intergenic
1093640414 12:21521176-21521198 GGGTAGATAAAAGTGAAGCAGGG - Intergenic
1093934249 12:24984033-24984055 AGGTATTGAAAACTGGAGTAAGG - Intergenic
1094119756 12:26958600-26958622 TGGTATACAATACTGGGGCAAGG - Intronic
1095222148 12:39628467-39628489 GGGTAAAAAGAACTCCAGCATGG - Intronic
1096186037 12:49581153-49581175 GGATATGTAGAACTGGAGCATGG + Intronic
1096757250 12:53810156-53810178 GGGTATAAGGAACTGGAAGACGG + Intergenic
1096861241 12:54529851-54529873 GGGTAGAGAAGACTGGAGTAAGG + Intronic
1098840900 12:75476713-75476735 GAGGATAAATAACTGGACCAGGG - Intergenic
1100129579 12:91474854-91474876 GTGGATAAAAAAGTGGAGAAAGG - Intergenic
1102837145 12:116075253-116075275 GGGGATAAATAACTTGACCAAGG - Intronic
1103232375 12:119342394-119342416 GAGTATAGAAAGCAGGAGCAAGG + Intronic
1104393259 12:128409061-128409083 GGTTTTAAAAAACAGAAGCAAGG + Intronic
1105791390 13:23803061-23803083 GGGTATAAAAAACACTATCATGG + Intronic
1106686527 13:32066075-32066097 GATTATAAAAAACTTGAGTATGG - Intronic
1106883189 13:34153926-34153948 GGGTACAAAAAAATGCACCAGGG - Intergenic
1107372956 13:39772197-39772219 GGTTAAGCAAAACTGGAGCAAGG - Intronic
1107548583 13:41455907-41455929 GGGAACAAAGAAATGGAGCATGG - Intergenic
1110504668 13:76271798-76271820 GGATAGAAAAAAATGGAGGAAGG + Intergenic
1112923290 13:104641801-104641823 AGGTATAAAAAGCTTGAACAAGG + Intergenic
1113148546 13:107236420-107236442 TGGGATAAAAAATAGGAGCATGG + Intronic
1113349957 13:109519453-109519475 GGGAAGAAACAATTGGAGCAGGG + Intergenic
1113393199 13:109917656-109917678 GGGTATAAACAAGTGCAGAAAGG + Intergenic
1113455146 13:110443454-110443476 GGGTGGAAATAACTGGAGTAAGG - Intronic
1114827992 14:26104931-26104953 GAGTACATAAAACTGGAACATGG + Intergenic
1116085179 14:40228030-40228052 TGGGATAAAAAACTGGAGAGTGG - Intergenic
1116224127 14:42126388-42126410 GGGTATAAGAAAGTGGAGGTTGG + Intergenic
1116658852 14:47682084-47682106 GGGGAAAAAAACCTGTAGCAAGG + Intergenic
1117459260 14:55928215-55928237 GGGGATAAAAAAGTGTAACATGG + Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1122757541 14:103994306-103994328 GGGAAGAAAAAAGTGGAGGAGGG - Intronic
1124103660 15:26717719-26717741 GGGAAGAAAAATATGGAGCAAGG - Intronic
1124190337 15:27569972-27569994 GGGAATAAAAAGCTGTAGCTTGG - Intergenic
1126287872 15:47035402-47035424 GGATATAAAAGACTGTAGCTGGG - Intergenic
1128356054 15:66927352-66927374 GGGTATAGCAAAGTGGAGAATGG + Intergenic
1129102089 15:73274651-73274673 GGGAAGAAAAAACAAGAGCAAGG - Intronic
1134070303 16:11256214-11256236 CGGTTTAAAAGACTGGCGCAGGG - Intronic
1138116314 16:54363406-54363428 TTTTAAAAAAAACTGGAGCAAGG + Intergenic
1138239391 16:55414787-55414809 GGGTAGACAGAACTGGAGGAAGG + Intronic
1140213982 16:72992834-72992856 GGGCATCAAAAACTGCAGAAAGG + Intronic
1144587339 17:16495169-16495191 GGGTAAAAAAATCAAGAGCAAGG - Intergenic
1144657004 17:17043050-17043072 GGGAAAATAAAAATGGAGCAGGG + Intronic
1146789223 17:35742163-35742185 GGGAATAAAGGACTGGAGCCTGG - Exonic
1147775870 17:42900765-42900787 GGGCATATAAAACAGGGGCAAGG + Intergenic
1153249832 18:3110249-3110271 ATGTTTAAAAAACTGAAGCATGG + Intronic
1153588828 18:6651879-6651901 GCATGTAAAATACTGGAGCAGGG - Intergenic
1154985737 18:21549145-21549167 GGGTCTCAAAAATTAGAGCAGGG - Intronic
1157464809 18:47933920-47933942 GGGAAAAAAAAACTGGAAGAAGG - Intergenic
1158818949 18:61136120-61136142 CAGTGTAAAATACTGGAGCAAGG + Intergenic
1158890812 18:61870412-61870434 GGTGGAAAAAAACTGGAGCAGGG - Intronic
1161189056 19:2943190-2943212 GGGTATAAGCAACAGGGGCATGG - Intronic
1161894034 19:7066836-7066858 GGATATAAGAAAAAGGAGCAGGG + Intergenic
1163533116 19:17862237-17862259 GGGTCTAAAAAGCTGGAGGCGGG - Intronic
1163810815 19:19430313-19430335 GGAAAGAAAAAACTGAAGCAAGG - Intronic
1164550571 19:29208135-29208157 GGGAATAACAAACAGAAGCAGGG + Exonic
1164677408 19:30110953-30110975 AGATATAAAAAGCTGGAGAAAGG + Intergenic
1164742856 19:30589599-30589621 GGGGATAAAGAAATGAAGCAAGG + Intronic
1166181215 19:41110485-41110507 GGGAAGAAAAAACTAGAACAGGG + Intergenic
929390723 2:41465664-41465686 GGGAAAAAAAAACTGCAGCCTGG - Intergenic
930030572 2:47055989-47056011 GGGAAGAAAAAGCTGGAGCCAGG - Intronic
931084902 2:58819081-58819103 TGGTTTAAAAAAGTGGAGCTGGG - Intergenic
931970180 2:67577303-67577325 GGCTATAAAAAAGTGGAATATGG + Intergenic
933525687 2:83435652-83435674 GGAAAGAAAAAGCTGGAGCATGG - Intergenic
937278181 2:120699719-120699741 GGGAAAAACAAACCGGAGCAAGG + Intergenic
937836384 2:126474417-126474439 GGGTATCAGAGAGTGGAGCATGG + Intergenic
940281289 2:151992291-151992313 GGGTATAAGACAATGCAGCATGG + Intronic
943610669 2:190030195-190030217 AGCTATAAAAACCAGGAGCAAGG - Intronic
943682858 2:190786318-190786340 GATTATAAAAACCTGGGGCAGGG - Intergenic
947174874 2:227355445-227355467 GGGCACTAAAAACTGGAGAATGG - Intronic
1168982785 20:2022138-2022160 GAGTAATAAAAACTGCAGCAGGG - Intergenic
1169899944 20:10542836-10542858 GGGTAGCAAAAACTGGATCTGGG - Intronic
1170230989 20:14045776-14045798 GGGAATTAAAAACATGAGCAGGG + Intronic
1172972983 20:38886988-38887010 GGGTATATATAACAGGAGCCTGG + Intronic
1174514795 20:51083466-51083488 GTGTAAAGAAAACTGAAGCAGGG + Intergenic
1177389509 21:20450044-20450066 AGATATAAAAAACTGGAGGTGGG - Intergenic
1178998682 21:37432486-37432508 AGGTATTAAAAACTTGACCAAGG + Intronic
1181295567 22:21835902-21835924 GGGCATGAAAGCCTGGAGCAGGG + Intronic
1181925985 22:26359032-26359054 GGGCAGAAAAAAATGGAGTATGG + Intronic
1183766004 22:39875506-39875528 GGGAATAACAAACAGAAGCAGGG - Intronic
1184914585 22:47560761-47560783 GTGGATGAAAAACTGGAGCTTGG + Intergenic
949701306 3:6762266-6762288 GGATATAAAAAACTGGGGAAAGG - Intergenic
949753406 3:7380595-7380617 GGCTATCAGAAACTGAAGCAAGG + Intronic
951734225 3:25846265-25846287 GGGTTTAAAAGACTGGGTCATGG - Intergenic
955123335 3:56083905-56083927 GGGAAAAAAAAAATGGAACAGGG + Intronic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
959698408 3:109274417-109274439 GGGGATCAAAACCAGGAGCAAGG + Intergenic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
961701542 3:128748522-128748544 GTGTATAGGAAACTGGAGGAAGG - Intronic
961865247 3:129949117-129949139 GAGTACAAACAACTGGACCATGG - Intergenic
962345244 3:134613931-134613953 GTGTATAAAGCACTGTAGCAGGG + Intronic
964198366 3:154089757-154089779 TGGTTTAAAAAAATGAAGCATGG + Intergenic
964699930 3:159554682-159554704 GGGCATCAAAGCCTGGAGCAGGG - Intronic
965779571 3:172270393-172270415 GGGCACAGAGAACTGGAGCAGGG - Intronic
966268848 3:178080921-178080943 GGGTATAATAATCTGCAGCTTGG - Intergenic
966825211 3:183959198-183959220 GGGTTTAAGAAACAGGATCAAGG + Intronic
970061056 4:12034913-12034935 GGGTATTAAAAAATGTAGGAAGG - Intergenic
976756776 4:88507000-88507022 GGGTAAAAAAAACTTAAGGACGG - Intergenic
977337650 4:95718658-95718680 GGGTATAAAACAATGGTGGAAGG - Intergenic
978575164 4:110182603-110182625 GATTATAGAAAACTGGAACAGGG + Intronic
981181928 4:141756111-141756133 GAGTAGAAAAAAATGGGGCAGGG - Intergenic
987227472 5:15858165-15858187 AGATGGAAAAAACTGGAGCAGGG + Intronic
990178931 5:53138858-53138880 GTGTACAAAACACTGGAGCATGG - Intergenic
990297135 5:54413643-54413665 GGGTCTAAGAAACGGGGGCAGGG - Intergenic
994279110 5:97878754-97878776 TGGTTTAAGAAAATGGAGCACGG + Intergenic
1001776817 5:174335106-174335128 GAGTTTGAGAAACTGGAGCAGGG - Intergenic
1002597389 5:180333191-180333213 AGATATAAAAAAATGGAGAAGGG - Intronic
1003915541 6:10783327-10783349 GGGTATATGAATCTGGAGCTTGG - Intronic
1004040408 6:11969672-11969694 GGGTATAAGAAACTGGGGTCTGG + Intergenic
1004298903 6:14439375-14439397 GGCGAAAAAAAACTAGAGCAAGG + Intergenic
1005033973 6:21538304-21538326 GGGTCAGAAAAACAGGAGCAAGG - Intergenic
1007141486 6:39579374-39579396 GGGAATAAATAATTTGAGCAAGG - Intronic
1007866897 6:44981248-44981270 GGGTATAAATAAATGAAGGATGG + Intronic
1008101716 6:47398763-47398785 GGGTATCAAAAAGGTGAGCATGG + Intergenic
1008119959 6:47602023-47602045 GGGTTTAAAACAATGGAGGAGGG - Intronic
1010808259 6:80264878-80264900 GGGGATTAAAAAATGGAGAAAGG + Intronic
1014514973 6:122366705-122366727 GGGTATATGAAAGTGGAGCCAGG + Intergenic
1016071527 6:139744926-139744948 GGGAATGAAAAACAGGAGGAAGG + Intergenic
1016554931 6:145325907-145325929 GGGTTTTAAACACTGGTGCATGG - Intergenic
1017611350 6:156189721-156189743 GGACATAAAATACTGGATCAAGG - Intergenic
1018789297 6:167134408-167134430 GGGCCTAAAAAGCTGGAGGAAGG - Intronic
1022257730 7:28676076-28676098 GGGTATAAAAATCTCCAGCAAGG + Intronic
1022647008 7:32241040-32241062 GAGTAGAAAAGACTGGAGGAAGG + Intronic
1023767231 7:43522820-43522842 TGGTATAAAAGCCAGGAGCAGGG + Intronic
1032062109 7:128733613-128733635 GGGTGGAGAAAACTGGAGCAAGG - Intergenic
1037071682 8:14658197-14658219 AGGTATAACAAAGAGGAGCAAGG - Intronic
1039312409 8:36331700-36331722 GTGTACAAAGAACTGGATCAGGG + Intergenic
1039856438 8:41418885-41418907 GGTTATAAAAAGCAGCAGCAGGG + Intergenic
1041584065 8:59495554-59495576 GAGGATAAAAATCTGGAGCAGGG - Intergenic
1042652274 8:71056369-71056391 AGGAATAAAAAACTTCAGCATGG + Intergenic
1045640570 8:104246116-104246138 GACTATAAACATCTGGAGCAGGG - Intronic
1046182763 8:110673697-110673719 GGGTGGAAAACAATGGAGCAGGG - Intergenic
1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG + Intergenic
1047660520 8:127029531-127029553 AGCTATAAAAACCTGGAGAAAGG + Intergenic
1052253939 9:26431479-26431501 TGGTATAAAAAATTGGCACATGG + Intergenic
1055269583 9:74542842-74542864 GAGTATAAGAATCTGGATCAAGG + Intronic
1058167593 9:101637444-101637466 GGCTGTAAAAATATGGAGCATGG + Intronic
1060175359 9:121493648-121493670 GGGTAGAAAAAAATGGATCCTGG - Intergenic
1060614776 9:125002814-125002836 AGTAATAAAAAACTGGAGGAAGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1192018254 X:67355627-67355649 GATGATAAAAAACTGGGGCAGGG - Intergenic
1194878485 X:99219972-99219994 AGGTATTGAAAACTGGAGGAAGG - Intergenic
1196407760 X:115383115-115383137 GGGTATAAAAATCTGTAAAATGG + Intergenic
1197802937 X:130371258-130371280 GGGTACAAATAACTGGAGGTAGG + Intronic
1198343271 X:135735189-135735211 GGGAAAAAAAAACTGAGGCAGGG - Intergenic
1198808974 X:140515910-140515932 GGGTATAAGAAAGTGAAACATGG - Intergenic
1200832611 Y:7702150-7702172 GAGGAGAAAAAAATGGAGCAAGG + Intergenic
1201671475 Y:16526251-16526273 GTGTGAAAAAAATTGGAGCAGGG + Intergenic