ID: 1076935450

View in Genome Browser
Species Human (GRCh38)
Location 10:133565648-133565670
Sequence GAGAATTACCTCACATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076935450_1076935456 15 Left 1076935450 10:133565648-133565670 CCTGGAGATGTGAGGTAATTCTC 0: 1
1: 0
2: 3
3: 11
4: 128
Right 1076935456 10:133565686-133565708 GCACTAGTGCGCATGCGTAAAGG 0: 1
1: 0
2: 0
3: 0
4: 26
1076935450_1076935457 22 Left 1076935450 10:133565648-133565670 CCTGGAGATGTGAGGTAATTCTC 0: 1
1: 0
2: 3
3: 11
4: 128
Right 1076935457 10:133565693-133565715 TGCGCATGCGTAAAGGCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 12
1076935450_1076935458 23 Left 1076935450 10:133565648-133565670 CCTGGAGATGTGAGGTAATTCTC 0: 1
1: 0
2: 3
3: 11
4: 128
Right 1076935458 10:133565694-133565716 GCGCATGCGTAAAGGCGCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 10
1076935450_1076935453 -7 Left 1076935450 10:133565648-133565670 CCTGGAGATGTGAGGTAATTCTC 0: 1
1: 0
2: 3
3: 11
4: 128
Right 1076935453 10:133565664-133565686 AATTCTCCGGCAGGCCTGCGTGG 0: 1
1: 0
2: 0
3: 0
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076935450 Original CRISPR GAGAATTACCTCACATCTCC AGG (reversed) Intronic
901248768 1:7756215-7756237 GTGACTTACCTCACAGCACCAGG - Intronic
901586389 1:10297383-10297405 GAGAATGAACTTAAATCTCCCGG + Intronic
903165092 1:21514711-21514733 GATACTAACCTCACATCCCCTGG + Intronic
903387911 1:22941540-22941562 GAGACTTGTCTCTCATCTCCTGG + Intergenic
903842590 1:26254554-26254576 AAGAATAACTTCACATATCCAGG + Intronic
904446285 1:30575439-30575461 AAAAACTACCTCATATCTCCAGG + Intergenic
905093461 1:35448540-35448562 GAGAATTCCCACACATGTGCTGG + Intronic
905094011 1:35453567-35453589 GAAAATTATCTCATATCTCTGGG - Exonic
908248365 1:62245649-62245671 GACAGTTACATAACATCTCCAGG + Intronic
915074288 1:153296134-153296156 GAGAATTCCCTTCCCTCTCCAGG + Intergenic
917408484 1:174734484-174734506 GAGAACTTGCTCAAATCTCCAGG - Intronic
919165757 1:193889361-193889383 GAGACTGAACTCCCATCTCCTGG + Intergenic
921090931 1:211841963-211841985 GACAATTAAGTCACATCTTCAGG + Intergenic
921131907 1:212227148-212227170 GATAATTACCTAATATCCCCTGG + Intergenic
922881554 1:228985002-228985024 GAGAAGTCCATCACATCTCTTGG - Intergenic
1063432510 10:6002995-6003017 CAGAATCATCTCACATCTTCTGG + Intergenic
1068215433 10:53977114-53977136 GACACTAACCTCCCATCTCCTGG + Intronic
1070523732 10:77276953-77276975 GAGAATTACCTAACAGCCCTGGG - Intronic
1075158456 10:120001487-120001509 GAGAATCACCTCATCACTCCAGG - Intergenic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG + Intronic
1097203546 12:57300598-57300620 GCAAATTACCTGACCTCTCCAGG + Intronic
1097691171 12:62735898-62735920 GAGAACTACCTTCCATTTCCAGG - Intronic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1100987349 12:100215406-100215428 GAGAATAACCACACCTCTACTGG - Intronic
1102352882 12:112207536-112207558 GAAAATTACTTAACATCTCTGGG - Intronic
1105046916 12:133012254-133012276 GAGAAATACCTCCCCTCTCTGGG + Exonic
1106369572 13:29118301-29118323 AAGAATCATCTCACCTCTCCTGG - Intronic
1106796717 13:33214009-33214031 GAAGATTACTTCACCTCTCCCGG + Intronic
1108554649 13:51581293-51581315 GAGAATTGCCTCATCTCTTCTGG - Intergenic
1108747624 13:53410753-53410775 AAGAATTCCCTGACCTCTCCAGG + Intergenic
1108862077 13:54873178-54873200 TAAAATTACTTAACATCTCCAGG + Intergenic
1111890399 13:94074635-94074657 GACAATTACCCCAAATCACCTGG + Intronic
1112023562 13:95392570-95392592 GAGAATTATCTCCCATTTCTGGG + Intergenic
1118971078 14:70638722-70638744 GAGAATCATCTCCCCTCTCCAGG + Intergenic
1121227362 14:92330931-92330953 GCGAGTTTCCACACATCTCCTGG + Intronic
1124153370 15:27202503-27202525 GTGAATTACCACATCTCTCCTGG - Intronic
1125421604 15:39510225-39510247 GAGAATGAGCTCACAACTGCGGG + Intergenic
1129560971 15:76568161-76568183 GACAAGTACCTCACATGTCATGG + Intronic
1130640168 15:85665472-85665494 GAGAATCAACTGACATTTCCTGG - Intronic
1131333272 15:91522559-91522581 GAGAAAGACCACACCTCTCCAGG - Intergenic
1132016169 15:98319225-98319247 GAGACTGATCTCCCATCTCCTGG + Intergenic
1134784586 16:16930225-16930247 GTGAGTTACCTTACATCTCTGGG - Intergenic
1137937098 16:52645259-52645281 AAGAATTAAGTCAGATCTCCAGG + Intergenic
1141864049 16:86737631-86737653 GAGGGTCACCTCACCTCTCCTGG + Intergenic
1144300203 17:13916567-13916589 GAGCATTACCTCTCATATCTAGG + Intergenic
1144791117 17:17859985-17860007 GGGAAGTCACTCACATCTCCTGG + Intronic
1146129890 17:30263018-30263040 GACATTTACATAACATCTCCAGG + Intronic
1160399602 18:78600467-78600489 GAGAATTTCCTCCCCTCTCCTGG - Intergenic
926432449 2:12802135-12802157 GAGACTGATCTCTCATCTCCTGG + Intergenic
928368778 2:30723559-30723581 GAGATGTTCCTCCCATCTCCAGG + Intronic
931034066 2:58216799-58216821 GAGAACTACCCCACATCTCTAGG - Intronic
931488730 2:62721476-62721498 GAGAATTAAGTTTCATCTCCTGG + Intronic
932828258 2:74961070-74961092 GAGAAATGCATCACATCTTCAGG - Intronic
938171221 2:129078612-129078634 GAGAAGGACCTCACCTCTCAGGG - Intergenic
938645269 2:133324144-133324166 GAAATTTACCTCACCTATCCCGG + Intronic
938856502 2:135317700-135317722 GAGGATTTCCTCACTGCTCCAGG + Intronic
938927293 2:136055696-136055718 CAGATTAACCCCACATCTCCAGG - Intergenic
942566750 2:177272161-177272183 TAAAATTATCTCACCTCTCCAGG - Intronic
943709110 2:191070437-191070459 GTGAGTTACTTCACATCTCGTGG - Intronic
943805198 2:192115785-192115807 GAGTATCACCTCACGTCTGCTGG + Intronic
943824686 2:192373981-192374003 GAGAATTCCATCATATATCCTGG - Intergenic
945001274 2:205353667-205353689 GCAAATGACCTCACTTCTCCAGG - Intronic
945433505 2:209793120-209793142 GAAAAATATCTCACATCACCTGG + Intronic
946056278 2:216904924-216904946 GAGTTTTACCTCACACCACCAGG - Intergenic
947917266 2:233840990-233841012 AAGTATTGCCTCAAATCTCCTGG - Exonic
947995859 2:234526592-234526614 GAGAATTACTATCCATCTCCTGG + Intergenic
1171021404 20:21587318-21587340 CAGAACAACCCCACATCTCCAGG - Intergenic
1172960370 20:38794913-38794935 GACAATTTCCTCACATTTCTGGG + Intergenic
1173382219 20:42556039-42556061 GAGAGTTACATCACTTCTCTGGG - Intronic
1174568712 20:51485690-51485712 GAAAGTTACTTTACATCTCCAGG + Intronic
1175347294 20:58289248-58289270 GATAATTAGCTCTCAACTCCAGG - Intergenic
1176938599 21:14896969-14896991 TAGAATTACCTCTCATCTCTAGG - Intergenic
1177049566 21:16215277-16215299 GACAATTACCTTAAATCTTCAGG - Intergenic
1177569970 21:22874566-22874588 AAGAAATAACTCACATGTCCTGG - Intergenic
1179236511 21:39552033-39552055 GAGACTGAGCTCCCATCTCCTGG - Intergenic
1179285081 21:39970287-39970309 GAGACTTGCCTCCCATCTTCTGG + Intergenic
1184339382 22:43877798-43877820 GGGAAATTCCTCACCTCTCCAGG - Intergenic
949291492 3:2471957-2471979 GAGAAATACTTCACATCTATGGG - Intronic
950531680 3:13555971-13555993 GTCACATACCTCACATCTCCTGG + Intronic
951580816 3:24160523-24160545 GAGAATTTCCTCAGCTCTCTTGG - Intronic
957737693 3:84224439-84224461 GAGAAATATCTCACATCACTGGG - Intergenic
959897508 3:111621034-111621056 CAGAATTAAATCACATGTCCTGG + Intronic
961128818 3:124446466-124446488 TAGCATTTCCTCACATCTCCTGG - Intronic
965168080 3:165222629-165222651 CAGGATTATCTCACATTTCCTGG - Intergenic
967703763 3:192625166-192625188 GAAATTTACCTCAGATATCCTGG - Intronic
967781855 3:193449056-193449078 GATTATGACCTCATATCTCCTGG - Intronic
967934775 3:194718244-194718266 GAGAATGAGTTCACATCTCCTGG + Intergenic
968939573 4:3630968-3630990 GAAAATCACCTCCCATTTCCGGG - Intergenic
969781541 4:9408441-9408463 GAGAAGTTCCTCACTTCACCTGG + Intergenic
977420415 4:96792529-96792551 GAGAATTTCATCACATTTTCTGG + Intergenic
977646588 4:99419569-99419591 GAGACTAACCTCACATTTTCTGG + Intronic
981389453 4:144171602-144171624 GAGAATCACCAAAAATCTCCTGG + Intergenic
982448327 4:155521586-155521608 GAGACTGATCTCCCATCTCCTGG - Intergenic
982927950 4:161363498-161363520 GAGAATTACATCAGATCTCCAGG + Intergenic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991938631 5:71828344-71828366 GAGAACTACCTCCTGTCTCCAGG + Intergenic
995322764 5:110855829-110855851 GAGAGTTACCTTACACCTCACGG + Intergenic
995575080 5:113521241-113521263 GAAAATTACTTAACATCTCTAGG - Intronic
999839593 5:155411057-155411079 GAGAATGTACTCACCTCTCCAGG + Intergenic
1002473130 5:179449290-179449312 GAGACTGATCTCCCATCTCCTGG - Intergenic
1002481094 5:179501364-179501386 GAGACTGATCTCCCATCTCCTGG + Intergenic
1002711750 5:181199072-181199094 GTGAGTGACCTCACAGCTCCTGG - Intronic
1004718527 6:18243174-18243196 GAGACATACCTCACCTCTCATGG + Intronic
1005822438 6:29608766-29608788 GAGAATTACCCCTCTTCTCCAGG + Intronic
1007259809 6:40555583-40555605 AAGAATTATCTCACAATTCCAGG - Intronic
1010498422 6:76565199-76565221 GCAAATTACCTAACATCTCTGGG - Intergenic
1013076808 6:106779137-106779159 GAGACTGATCTCCCATCTCCTGG - Intergenic
1015562136 6:134527323-134527345 GAGAGTTTCCTCACATATCTCGG + Intergenic
1015597563 6:134880262-134880284 GATTATTACCACAGATCTCCCGG - Intergenic
1018355524 6:163011059-163011081 GTGAATTAGCTCACCTCCCCTGG + Intronic
1019258478 7:66482-66504 GAGATTTGCCTCACGTCACCAGG - Intergenic
1024118562 7:46215134-46215156 GAGAGTTACCTTACATCTTAAGG - Intergenic
1026348762 7:69497566-69497588 GAGACTTATCTCCCATCTCCTGG - Intergenic
1026522251 7:71127725-71127747 GCAAATTACCTCACTTCTCTGGG - Intergenic
1032612575 7:133431058-133431080 GAAAGTTACCTGACATCTCTGGG - Intronic
1032636515 7:133714897-133714919 GAGAAAGACATCACATCTCTGGG + Intronic
1033342683 7:140504432-140504454 GAGACTGAGCTCCCATCTCCTGG + Intergenic
1035642493 8:1194520-1194542 GAGAATTTCTTCACATCACAAGG - Intergenic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1041830523 8:62147956-62147978 GAGAATAACCTCACTCCACCTGG + Intergenic
1042024621 8:64409711-64409733 TAGAGTTACCTCAGGTCTCCAGG - Intergenic
1044325553 8:90853828-90853850 GAGACTTATCTCCCATCTCCTGG - Intronic
1044326040 8:90859383-90859405 GAGACTTATCTCCCATCTCCTGG - Intronic
1044542912 8:93428012-93428034 GAGAATGAGCTCTCATCTCCTGG + Intergenic
1045153257 8:99434264-99434286 GACAATTTCCTCACATCTGTAGG - Intronic
1047819540 8:128503546-128503568 AAGAATTACCCCAATTCTCCAGG + Intergenic
1049188349 8:141271291-141271313 GAGCATCACCTCACAGCTTCTGG + Intronic
1049391084 8:142371993-142372015 CAGAATCACCACACATTTCCTGG - Intronic
1058645077 9:107124243-107124265 GAGAAGTACCTTACATGTGCAGG + Intergenic
1060017065 9:120096080-120096102 GATAATTTCCTCACACTTCCAGG - Intergenic
1060474729 9:123978192-123978214 GAGCATTGCCTCACCTCCCCTGG - Intergenic
1060476633 9:123991931-123991953 GAGCATTGCCTCACCTCCCCTGG + Intergenic
1186100848 X:6155051-6155073 AAGAATAAAGTCACATCTCCTGG + Intronic
1187318546 X:18220458-18220480 CAGGATCACCTCACGTCTCCGGG + Intronic
1188118013 X:26268654-26268676 AATAATTACTGCACATCTCCTGG + Intergenic
1192317422 X:70063589-70063611 GAGATTTCCCTCATATTTCCGGG - Exonic
1194060238 X:89187633-89187655 GCAAATTACCTCACATCTCCAGG - Intergenic
1197143067 X:123138219-123138241 GAGAATTTCATCACCTCTCCTGG + Intergenic
1197234509 X:124044453-124044475 CTGAATTACCTTACATCTCTAGG + Intronic
1199463542 X:148110976-148110998 GAGGATTATCTCTTATCTCCCGG - Intergenic
1202068938 Y:20970040-20970062 TGGAATTATCTCACAGCTCCTGG + Intergenic