ID: 1076936964

View in Genome Browser
Species Human (GRCh38)
Location 10:133572141-133572163
Sequence GGGAAAGGACAATAGCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936964_1076936972 -1 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936972 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
1076936964_1076936974 5 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936974 10:133572169-133572191 TTCCTGCTGGGAGTGGGACTTGG No data
1076936964_1076936980 30 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936964_1076936970 -2 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936970 10:133572162-133572184 CCCCTTTTTCCTGCTGGGAGTGG No data
1076936964_1076936967 -7 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936967 10:133572157-133572179 CTTTCCCCCTTTTTCCTGCTGGG No data
1076936964_1076936966 -8 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936966 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
1076936964_1076936978 17 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936978 10:133572181-133572203 GTGGGACTTGGTGCCGAGGGTGG No data
1076936964_1076936976 13 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936976 10:133572177-133572199 GGGAGTGGGACTTGGTGCCGAGG No data
1076936964_1076936977 14 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936964 Original CRISPR GGGAAAGGACAATAGCACAC AGG (reversed) Intergenic
No off target data available for this crispr