ID: 1076936965

View in Genome Browser
Species Human (GRCh38)
Location 10:133572156-133572178
Sequence CCAGCAGGAAAAAGGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936965_1076936977 -1 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data
1076936965_1076936981 26 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936981 10:133572205-133572227 TCCTGACATCGGAAGACCCCAGG No data
1076936965_1076936976 -2 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936976 10:133572177-133572199 GGGAGTGGGACTTGGTGCCGAGG No data
1076936965_1076936978 2 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936978 10:133572181-133572203 GTGGGACTTGGTGCCGAGGGTGG No data
1076936965_1076936974 -10 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936974 10:133572169-133572191 TTCCTGCTGGGAGTGGGACTTGG 0: 2
1: 0
2: 2
3: 32
4: 364
1076936965_1076936980 15 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936965 Original CRISPR CCAGCAGGAAAAAGGGGGAA AGG (reversed) Intergenic