ID: 1076936971

View in Genome Browser
Species Human (GRCh38)
Location 10:133572163-133572185
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936971_1076936976 -9 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936976 10:133572177-133572199 GGGAGTGGGACTTGGTGCCGAGG No data
1076936971_1076936980 8 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936971_1076936977 -8 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data
1076936971_1076936983 26 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936971_1076936981 19 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936981 10:133572205-133572227 TCCTGACATCGGAAGACCCCAGG No data
1076936971_1076936978 -5 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936978 10:133572181-133572203 GTGGGACTTGGTGCCGAGGGTGG No data
1076936971_1076936984 27 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936984 10:133572213-133572235 TCGGAAGACCCCAGGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936971 Original CRISPR CCCACTCCCAGCAGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr