ID: 1076936974

View in Genome Browser
Species Human (GRCh38)
Location 10:133572169-133572191
Sequence TTCCTGCTGGGAGTGGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936965_1076936974 -10 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936974 10:133572169-133572191 TTCCTGCTGGGAGTGGGACTTGG No data
1076936964_1076936974 5 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936974 10:133572169-133572191 TTCCTGCTGGGAGTGGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936974 Original CRISPR TTCCTGCTGGGAGTGGGACT TGG Intergenic
No off target data available for this crispr