ID: 1076936975

View in Genome Browser
Species Human (GRCh38)
Location 10:133572171-133572193
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936975_1076936981 11 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936981 10:133572205-133572227 TCCTGACATCGGAAGACCCCAGG No data
1076936975_1076936980 0 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936975_1076936983 18 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936975_1076936984 19 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936984 10:133572213-133572235 TCGGAAGACCCCAGGATGCTGGG No data
1076936975_1076936985 26 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936985 10:133572220-133572242 ACCCCAGGATGCTGGGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936975 Original CRISPR CACCAAGTCCCACTCCCAGC AGG (reversed) Intergenic