ID: 1076936977

View in Genome Browser
Species Human (GRCh38)
Location 10:133572178-133572200
Sequence GGAGTGGGACTTGGTGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936973_1076936977 -9 Left 1076936973 10:133572164-133572186 CCTTTTTCCTGCTGGGAGTGGGA No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data
1076936971_1076936977 -8 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data
1076936968_1076936977 -6 Left 1076936968 10:133572161-133572183 CCCCCTTTTTCCTGCTGGGAGTG No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data
1076936965_1076936977 -1 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data
1076936969_1076936977 -7 Left 1076936969 10:133572162-133572184 CCCCTTTTTCCTGCTGGGAGTGG No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data
1076936964_1076936977 14 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936977 10:133572178-133572200 GGAGTGGGACTTGGTGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936977 Original CRISPR GGAGTGGGACTTGGTGCCGA GGG Intergenic
No off target data available for this crispr