ID: 1076936979

View in Genome Browser
Species Human (GRCh38)
Location 10:133572194-133572216
Sequence CCGATGTCAGGAGCCACCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936979_1076936994 19 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936994 10:133572236-133572258 TCAGCGGCTAGGCGGGTGGAGGG No data
1076936979_1076936996 23 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936996 10:133572240-133572262 CGGCTAGGCGGGTGGAGGGTGGG No data
1076936979_1076936993 18 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936993 10:133572235-133572257 GTCAGCGGCTAGGCGGGTGGAGG No data
1076936979_1076936997 24 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936997 10:133572241-133572263 GGCTAGGCGGGTGGAGGGTGGGG No data
1076936979_1076936985 3 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936985 10:133572220-133572242 ACCCCAGGATGCTGGGTCAGCGG No data
1076936979_1076936991 12 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936991 10:133572229-133572251 TGCTGGGTCAGCGGCTAGGCGGG No data
1076936979_1076936983 -5 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936979_1076936995 22 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936995 10:133572239-133572261 GCGGCTAGGCGGGTGGAGGGTGG No data
1076936979_1076936990 11 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936990 10:133572228-133572250 ATGCTGGGTCAGCGGCTAGGCGG No data
1076936979_1076936992 15 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936992 10:133572232-133572254 TGGGTCAGCGGCTAGGCGGGTGG No data
1076936979_1076936984 -4 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936984 10:133572213-133572235 TCGGAAGACCCCAGGATGCTGGG No data
1076936979_1076936989 8 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936989 10:133572225-133572247 AGGATGCTGGGTCAGCGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936979 Original CRISPR CCGATGTCAGGAGCCACCCT CGG (reversed) Intergenic