ID: 1076936980

View in Genome Browser
Species Human (GRCh38)
Location 10:133572194-133572216
Sequence CCGAGGGTGGCTCCTGACAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936968_1076936980 10 Left 1076936968 10:133572161-133572183 CCCCCTTTTTCCTGCTGGGAGTG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936965_1076936980 15 Left 1076936965 10:133572156-133572178 CCTTTCCCCCTTTTTCCTGCTGG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936971_1076936980 8 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936964_1076936980 30 Left 1076936964 10:133572141-133572163 CCTGTGTGCTATTGTCCTTTCCC No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936973_1076936980 7 Left 1076936973 10:133572164-133572186 CCTTTTTCCTGCTGGGAGTGGGA No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936969_1076936980 9 Left 1076936969 10:133572162-133572184 CCCCTTTTTCCTGCTGGGAGTGG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
1076936975_1076936980 0 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936980 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936980 Original CRISPR CCGAGGGTGGCTCCTGACAT CGG Intergenic
No off target data available for this crispr