ID: 1076936983

View in Genome Browser
Species Human (GRCh38)
Location 10:133572212-133572234
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936968_1076936983 28 Left 1076936968 10:133572161-133572183 CCCCCTTTTTCCTGCTGGGAGTG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936975_1076936983 18 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936973_1076936983 25 Left 1076936973 10:133572164-133572186 CCTTTTTCCTGCTGGGAGTGGGA No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936979_1076936983 -5 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936971_1076936983 26 Left 1076936971 10:133572163-133572185 CCCTTTTTCCTGCTGGGAGTGGG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data
1076936969_1076936983 27 Left 1076936969 10:133572162-133572184 CCCCTTTTTCCTGCTGGGAGTGG No data
Right 1076936983 10:133572212-133572234 ATCGGAAGACCCCAGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936983 Original CRISPR ATCGGAAGACCCCAGGATGC TGG Intergenic
No off target data available for this crispr