ID: 1076936985

View in Genome Browser
Species Human (GRCh38)
Location 10:133572220-133572242
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076936979_1076936985 3 Left 1076936979 10:133572194-133572216 CCGAGGGTGGCTCCTGACATCGG No data
Right 1076936985 10:133572220-133572242 ACCCCAGGATGCTGGGTCAGCGG No data
1076936975_1076936985 26 Left 1076936975 10:133572171-133572193 CCTGCTGGGAGTGGGACTTGGTG No data
Right 1076936985 10:133572220-133572242 ACCCCAGGATGCTGGGTCAGCGG No data
1076936982_1076936985 -9 Left 1076936982 10:133572206-133572228 CCTGACATCGGAAGACCCCAGGA No data
Right 1076936985 10:133572220-133572242 ACCCCAGGATGCTGGGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076936985 Original CRISPR ACCCCAGGATGCTGGGTCAG CGG Intergenic