ID: 1076937739

View in Genome Browser
Species Human (GRCh38)
Location 10:133577036-133577058
Sequence CCTTCCTCACCGGTGCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076937729_1076937739 -7 Left 1076937729 10:133577020-133577042 CCAGCCTTCTACCACCCCTTCCT No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data
1076937722_1076937739 28 Left 1076937722 10:133576985-133577007 CCGTGGACAAGTGGAATTCCTGG No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data
1076937721_1076937739 29 Left 1076937721 10:133576984-133577006 CCCGTGGACAAGTGGAATTCCTG No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data
1076937728_1076937739 -6 Left 1076937728 10:133577019-133577041 CCCAGCCTTCTACCACCCCTTCC No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data
1076937727_1076937739 0 Left 1076937727 10:133577013-133577035 CCTTGACCCAGCCTTCTACCACC No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data
1076937725_1076937739 10 Left 1076937725 10:133577003-133577025 CCTGGGTGACCCTTGACCCAGCC No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data
1076937726_1076937739 1 Left 1076937726 10:133577012-133577034 CCCTTGACCCAGCCTTCTACCAC No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data
1076937720_1076937739 30 Left 1076937720 10:133576983-133577005 CCCCGTGGACAAGTGGAATTCCT No data
Right 1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076937739 Original CRISPR CCTTCCTCACCGGTGCTCGG GGG Intergenic
No off target data available for this crispr