ID: 1076938246

View in Genome Browser
Species Human (GRCh38)
Location 10:133580857-133580879
Sequence GTGCCGTTTTTTAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076938246_1076938250 3 Left 1076938246 10:133580857-133580879 CCAACCAGCTTAAAAAACGGCAC No data
Right 1076938250 10:133580883-133580905 AGGAGATTATATCCCACACTTGG No data
1076938246_1076938251 8 Left 1076938246 10:133580857-133580879 CCAACCAGCTTAAAAAACGGCAC No data
Right 1076938251 10:133580888-133580910 ATTATATCCCACACTTGGCTCGG No data
1076938246_1076938252 11 Left 1076938246 10:133580857-133580879 CCAACCAGCTTAAAAAACGGCAC No data
Right 1076938252 10:133580891-133580913 ATATCCCACACTTGGCTCGGAGG 0: 5
1: 529
2: 1470
3: 1565
4: 1345
1076938246_1076938255 25 Left 1076938246 10:133580857-133580879 CCAACCAGCTTAAAAAACGGCAC No data
Right 1076938255 10:133580905-133580927 GCTCGGAGGTCCTAAGTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076938246 Original CRISPR GTGCCGTTTTTTAAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr