ID: 1076940894

View in Genome Browser
Species Human (GRCh38)
Location 10:133607520-133607542
Sequence TGGTAGATGTAAAACTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076940894_1076940901 28 Left 1076940894 10:133607520-133607542 CCTGTCAAGTTTTACATCTACCA No data
Right 1076940901 10:133607571-133607593 GTTTATCTCCAAATTCCATCTGG No data
1076940894_1076940898 6 Left 1076940894 10:133607520-133607542 CCTGTCAAGTTTTACATCTACCA No data
Right 1076940898 10:133607549-133607571 GGAGCAGGAGTTAACCCTAAAGG No data
1076940894_1076940896 -9 Left 1076940894 10:133607520-133607542 CCTGTCAAGTTTTACATCTACCA No data
Right 1076940896 10:133607534-133607556 CATCTACCACATCAAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076940894 Original CRISPR TGGTAGATGTAAAACTTGAC AGG (reversed) Intergenic
No off target data available for this crispr