ID: 1076943990

View in Genome Browser
Species Human (GRCh38)
Location 10:133631219-133631241
Sequence GAACCAGGGGTTGTTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076943990_1076943996 24 Left 1076943990 10:133631219-133631241 CCAGGGGGAACAACCCCTGGTTC No data
Right 1076943996 10:133631266-133631288 CATGCATTCCATGTGTGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076943990 Original CRISPR GAACCAGGGGTTGTTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr