ID: 1076946292

View in Genome Browser
Species Human (GRCh38)
Location 10:133653348-133653370
Sequence TCTTGGGTGGACAGGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076946287_1076946292 0 Left 1076946287 10:133653325-133653347 CCAGTTGTTTTTGCTTAGGATTG No data
Right 1076946292 10:133653348-133653370 TCTTGGGTGGACAGGCAAACAGG No data
1076946285_1076946292 7 Left 1076946285 10:133653318-133653340 CCAGCTACCAGTTGTTTTTGCTT No data
Right 1076946292 10:133653348-133653370 TCTTGGGTGGACAGGCAAACAGG No data
1076946284_1076946292 10 Left 1076946284 10:133653315-133653337 CCTCCAGCTACCAGTTGTTTTTG No data
Right 1076946292 10:133653348-133653370 TCTTGGGTGGACAGGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076946292 Original CRISPR TCTTGGGTGGACAGGCAAAC AGG Intergenic
No off target data available for this crispr